The Head Cult

Next Full Moon

2011-12-08T08:44:00.003-05:00

Claire sneaked into the workshop as soft as her tip toes could carry her. She saw the warm orange glow of candlelight just beyond the shadow of her grandfather. He was hunched over his workbench, toiling furiously as his hands turned tools and parts into some new creation. The bits of metal and wire seemed to be flowing from his palms like breath from lungs. Creeping closer, Claire grasped his sides with her small child hands and squeezed. The unsuspecting victim leapt in his seat with a yelp, and piles of screws, bobbins, and tools tumbled to the floor.

"Claire! How dare you scare an old man like that! You might have broken something!" He snipped the pliers in his hands at her nose. Claire giggled and jumped backwards holding her face as if there was a chance that her grandfather plucked her nose clean off.

"But I hadn’t expected to see you for three more days!" he said, wrapping his arms around her, "Why are you here so early, my beloved girl?"

"Mom and dad dropped me off early," she said, looking coy with those almond eyes, "You aren't mad, are you?"

"Of course not, just startled is all." He reached down and scooped her into his lap as if she were weightless. "I have a surprise for you!"

Claire's face lit up in anticipation. "I love surprises!"

"As any eight-year old should!" he laughed, "Here, see this." He turned his stool to show Claire what he was working on. In the middle of the debris of pliers, lenses, wires, brass, and wood sat what looked to be a small typewriter. It had golden brass inlaid keys with lettering, dark wooden paneling, and a small spindle of paper set right above the keys. Behind the keys and paper, the box was wide open and Claire could see inside complex wiring and electronics that she had never seen before. A small lens protruded above the mechanics but the machine was clearly unfinished. Beside the machine was a wooden box just slightly larger than the machine. It had carvings in the sides and lid of birds in flight, though it too appeared unfinished.

"What is it?" Claire asked.

"This is a very special invention," her grandfather said, "My hope is that this box will help people when they need it most."

"But what does it do?" she asked, poking at the brass keys with her fingers.

"Well, you put a small bit of blood in this thing here..." he reached around a grasped a glass vial and placed at the side of the box, "... and then the machine reads your blood and tells you how you will die."

Claire laughed, "No one wants to know that, grandpa!"

He nodded but with gleam in his eyes behind his round spectacles. "Death is something that most people don't want to talk about, I agree. But I believe it's something we need to talk about, nonetheless. This machine starts the conversation only by telling you how it will happen."

"Do you mean if you're sick?"

"Perhaps, but any other way, as well. If it is an accident, or a sickness, or the result of a foul scheme, this box will tell you."

"How does it do that?"

"It reads your blood. Blood always tells the truth."

"But how does blood know? Blood is just blood."

Her grandfather gave her a small hug and heaved a sigh, "Many people have forgotten some of the deepest and best ideas in life, Claire. Ideas like 'There is nothing new under the sun' or 'Life is one great story that connects us all.' And life is more simple than what first meets the eye. We are all born, we all breathe, grow, and we all die. The experience is unique to each person but we all share in joy, pain, and grief in some way. And deep inside, it's our blood that tells our story."

"How?"

"That's another thing people have forgotten. Our soul is in our blood. Every little cell tells your story from beginning to end, from when you're born and how you grow up, to how you die. The smallest part of ourselves speaks with every other cell and every other person, whispering our beginnings and ends, but it speaks so quietly that we often do not hear them. This box helps make the telling of our stories just a little louder."

Claire became quiet. She was busy thinking whether it would be a good or bad thing to know how she would die or to talk with her blood. "Grandpa, isn't it scary to die?"

"For some it is," he answered truthfully, for he always tried to tell the truth, "There' a lot that we cannot know about what it means to die but we know it hurts a lot when we lose someone we love. And so I wondered, too, what could I do to make the telling of the ends of our stories a little easier. And then I had a fabulous idea! Do you want to hear it?"

Claire nodded once, up and down.

"I thought of you! I thought of how much easier it would be to get such news from someone I loved and trusted. This is part of the secret," he pointed at the lens at the open end of the machine, "From this little lens, when you choose to use the machine, the person most important to you will emerge and tell you how you're going to die. It helps to hear these things from someone you love. Sometimes they can teach us what it means to die well."

"But how does it know who to show?"

"Your blood knows. You can feel it deep down when you truly love someone. That's because it's in your blood. Even when they're far away and you haven't seen them for a very long time, you can sometimes feel them speaking to you. That's your blood reminding you that you are loved."

He turned the stool away from the workbench and set Claire back down on solid ground, "But, that's enough for now. Come on. Let's go get dinner started. How does liver and onions sound?"

Claire wrinkled her nose, crossed her arms and stomped her foot hard. "Well," he exclaimed, "If not liver and onions then we'll have to have ice cream! That's all the food I have!"

Claire smiled and grabbed his hand, calloused hard from years of crafting. They walked out to the house, "I always feel better when you're around, grandpa. I feel it deep down. Is that my blood talking to me?"

"I think it is, and my blood says the same thing." He smiled wide until white teeth peeked through his thick beard. Patting her head they walked into the moonlit night towards a dinner of ice cream.

#

Claire didn't recognize where she was. The walls and floors were white and everyone was wearing white clothing. All the brightness reminded her of her grandfather; white was his favorite color. Claire would have done anything to see her grandfather at that moment. She was tired, cold, and in pain. All the strangers around her kept saying how brave she was but she didn't want to be brave. She only wanted to go home.

"I'm afraid its cancer." One of the men in white said. "A rare form of leukemia. There are some treatments, some things we could try to fight it with, but I'm not going to lie to you. Not much is known about it and there's no guarantee anything will work and it will be very hard to fight."

"How long?" Claire's father asked. It looked to Claire that he was angry so she was too scared to say anything.

"It’s hard to say. Everything points to a slow growth, but if it’s metastasized to the lymph nodes then I'm afraid I can only put the survival rate at 10%. At the current rate of growth with chemotherapy and treatments, maybe two or three years at most."

Her father sighed and her mother began to cry. Claire was feeling scared and she didn't understand what was happening. There had been lots of needles and cold metal surfaces with strange lights and beeps. She knew she was sick but she didn't feel too bad. Surely it wasn't anything a bowl of soup and an afternoon of blankets and books couldn't fix.

"I know it’s difficult to hear but some decisions need to be made soon."

"Do everything you can." Her father said sternly.

"I just want you to understand. This can be a hard and painful process, and with the survival rate being what it is there are other options that can improve quality of life..."

"No." Her father almost screamed, "Do everything you can."

"Very well." The man in white jotted down some notes and nodded.

The three adults looked to Claire in the hospital bed. Her parents crouched beside her while the man in white smiled and squeezed her hand. He was kind, but there was something not right about that smile to Claire. It wasn't warm, like the way her grandpa used to smile at her. When grandpa smiled she felt it deep down, "in her blood" as he used to say. The stranger's smile was more like a mask, distant and fake. Surfacey. Not deep at all.

"I don't like it here. I want to go home."

"Honey, you're going to have to stay here for a while." Her mother said as she knelt next to her. She wiped Claire's cheeks that were dry as tears poured down her own. Claire didn't understand why she was crying but she knew something serious was happening.

"Mom, what is it?"

A nurse came up and poked Claire's arm with a long needle. The pain shot up to her shoulder but she only watched as the blood traveled through her veins into the clear plastic tube.

"You're very sick, dear." It was all her mother could say before sobbing.

"Grandpa says our blood speaks to us." Claire said as she watched the blood be taken from her.

"Your grandfather said a lot of strange things, Claire," her father said.

"Is grandpa coming to my eleventh birthday?"

"No, dear, grandpa isn't coming to any more of your birthdays. We talked about this. Grandpa's gone."

For some reason, Claire kept forgetting what had happened. It was only last week when her father woke her in the early hours of the morning. She could hear her mother crying in the other room. Her father spoke her name loud enough to wake her. When she rubbed the sleep from her eyes she saw him sitting on the bed next to her, his face blank showing no emotion.

"I have to go, Claire." He began, "Last night, grandpa had an accident. I'm afraid he's gone, Claire. Grandpa's gone."

He spoke in a very matter-of-fact tone with lots of nods and eye contact. But he never hugged her.

Claire felt numb. "What happened?"

"He was walking home from a lecture at the college late last night. His neighbor was outside on the roof doing some stargazing when he took a misstep and knocked a telescope over the side. It hit your grandfather as he was walking underneath."

And that was it. That's how grandpa died. It wasn't until she was in that hospital room with all of the white and strangers and big words like 'leukemia' and 'chemotherapy' that she began to feel like he was really gone. Tears began to stream down her face.

The man in white clipped something to his notepad and turned to the father. "For what it's worth, I'm sorry. I'll do everything I can."

"I know. And thank you, doctor. What would be the plan from here?"

"Well, we'll keep her overnight for more tests, start her on chemo every six weeks..."

Claire could hear the voices trailing off but could feel something else growing inside her. She began to feel fearful, like she was standing before a great mouth that was yawning to swallow her whole. There came a ringing in her ears that wouldn't stop, and the sounds of voices became less and less until she could her nothing else around her. She could only think about how much she missed her grandfather and the hurt of his death clamored over all of her senses. Claire closed her eyes and went inward. No one around her seemed to see her, so she tried to see herself. She could feel, deep down in her blood, a cavernous yearning and pain. She never felt anything so terrible and she was scared she would become lost in the interior world of grief. It was then that another pain shot up her arm and suddenly she was back in the room with white walls. A nurse had put in a small needle that was connected to a large bag holding a clear liquid. Claire's arm ached as she felt the cold juice run into her veins.

"So you've finally woken up." She said, "You were asleep for quite a while!"

Claire didn't feel she had slept at all but she noticed she was in a different room. Claire looked around and saw that her parents and the man in white had gone. The nurse took notice of her searching eyes.

"Your parents stepped out for some dinner but they'll be back soon." She ripped off her blue gloves with a snap. "They left that letter for you. They said it’s an early birthday present."
Beside the bed was an envelope with two words scribbled on the outside, 'From Grandpa.' When she lifted it Claire noticed it felt heavy; there seemed to be more than just a letter inside. She tore open the top and gently pulled at the parchment with trembling fingers. She read the words on the page:

Dearest Claire,

First and foremost, I'm sorry I will not be there for your eleventh birthday. It seems that this world has a different plan for me.

I had hoped to see you grow into a beautiful woman, to watch as you learned and loved and walked the path of discovering yourself. There's so much I had hoped to teach you but I'm afraid I must leave your life a bit early. I used my greatest invention today and it told me how I would die, and judging from the words I had surmised that I would be dying soon. But the news came from the lips of a face that looked like yours, so it wasn't terrible. To be sure, I've lead a wonderful and joyous life and it was made better because of your love. Even though I may be dying in body, know that my blood is always a part of yours and that my love is just as close to you as your next breath of air.

One day, when you're ready, use this key to access my machine. Only use it if you truly want to know how your story will end. Remember, it MUST give a prediction when used and you may not like what you hear even though the news will come from someone you love. But I've taught you all I can with the time I had and someone who lives well has nothing to fear of death. So it is with me. Though I must admit I am curious to learn how it will actually happen... I left you my prediction so you too can see how odd it was.

I will cherish you always and if you ever call out my name, I promise I will hear you.

Remember, we are all connected.

Your Grandpa

Inside the envelope was a small brass key and a tiny slip of paper that read NEXT FULL MOON.

Claire cried. Even though she knew her grandfather meant every word of that letter, she didn't feel loved or heard. He was gone. In those moments after reading the letter Claire never felt more alone in her life. It felt as though her very blood was shaking in anguish. She retreated inward again, trying to make herself feel as she did when her grandfather would see her and smile. She tried to remember his face with the round spectacles, funny wrinkles, and gray beard. She tried to hear his voice and feel his calloused hands patting her head. But she couldn't. It was almost like she forgot. No, it was more like her soul forgot, her blood forgot. In the darkness of herself, in that loneliness, Claire didn't know what to do. She felt the world around her begin to disappear in despair when a stab in her arm brought her back to the present moment. She must have been shaking; the small needle in her arm had gotten loose and had come out with a jerk at her vein. It was dripping slowly onto the floor. She lifted to look at the needle closer and she saw a few small drops of blood on the tip. The pain inside was too much to bear, yet the pain in her body and underneath her skin would bring her back. A sharp stab saved her from the sadness. For Claire, there was nothing worse than the thought of never seeing her grandfather again. She took the needle, bit her lip, and stabbed it back into place.

That time the pain felt better.

#

"Claire? Where are you?" Her father's voice was muffled through the wood and insulation, like a voice that whispered in her head.

Claire was hiding. She was doing a lot of hiding the past few weeks and this time she chose the attic as her secret place. She liked the attic because her parents never thought she could get up there and no one ever found her. It was dark and musty and smelled of rotting wood, but at least she could be alone. She was in the dark and had nothing with her but a Swiss Army knife and an old yellow flashlight with a burning-out bulb. She hit it once to get it shining again.

She held the small Swiss Army knife that had been a present from her father for her fourteenth birthday. Its blade was open and wet. Claire had made a small fresh cut just above the crease of her arm. The scars on her skin from countless IVs and surgical procedures mixed with the scars of some of her personal incisions. Some were made by doctors. Some were made by her. She poked at the newest line with her pinky. The muscle beneath responded and surged with a new mound of blood. The pain was too dull to notice anymore but it kept her out of her head still. Claire watched as a small drop of red weaved and rivered its way between the hairs of her arm down to her elbow. She was comforted by the sight of her own blood. It helped her to remember that she was still alive even if she didn't want to be, and a part of her still believed that her grandfather was in that red liquid somewhere. Over the course of the last three years she had lost weight, any sense of dignity, and almost all of her hair three times. She knew it would never grow back to flow past her shoulders again.

She was still feeling a little sick from the chemotherapy the day before. Her cancer had slowed its growth but her body was exhausted. She was scheduled for another visit later in the day. That's what she was hiding from. She hated the hospital. Nothing but machines and needles and people who look at you but never saw you. Some days Claire was strong and she could handle it but today wasn't one of those days. She toyed with the small, brass key that hung from her neck when there came a distinct sound.

*click*

Claire jumped. The sound came from a dark corner of the attic but she wasn't sure from where. Did her parents finally discover her favorite hiding spot?

*click*

She jumped again. It was a short sound, but clear. She shined the flashlight toward the corner and saw a stack of boxes covered by a dark green blanket.

*click*

Claire pulled at the blanket with a swift tug. The sound was coming from a small box in the middle of the stack. Claire grabbed the box and pulled it out. It was heavy with an ornate lid carved depicting birds spreading their wings and a small keyhole on the front. She slowly placed it on the wooden floor before her and shined the flashlight on it. The light flickered and warmed the decorated lid so that the carved birds appeared to be flying off the paneling. That's when she knew what this box contained.

*click*

Hands trembling, Claire took the key from her neck and pushed it into the keyhole. She turned it clockwise and the lock gave way with a mechanical shift. She slowly opened the lid to look inside.

*click*

It was the machine from years ago, the one her grandfather had made, the one that could tell you how you would die. Claire remembered the typewriter look, the brass accents, the deep wood paneling, but the machine looked complete. The glass vial rested on the side awaiting a sample of blood and the paper spindle was slowly turning.

*click*

The paper jerked in the other direction as if it were catching on some internal mechanism. Claire slowly removed the paper to find a piece was caught on the turning gear. Had this machine been on all this time? Her grandfather had been dead for years. How was it still functioning?

The clicking ceased. Claire removed the machine from its ornate box and placed it squarely on the attic floor. The light of the flashlight danced across the brass and varnished wood. The machine looked pristine and newly polished. It had an old-fashioned look, but she knew that the mechanics inside were as advanced as technology could get in their time, perhaps even more so. Despite what everyone believed, Claire knew her grandfather was a genius. She smiled remembering his odd sense of style; mixing the old and new.

There were small plaques of gold adorning the sides and face of the machine. Claire read on the left, "Always tell the truth" and on the right "Everything is connected." These were common sayings of her grandfather but the message on the front was the most enigmatic, "Die well."
"I've wanted to," Claire said to herself upon reading the plaque, "Life's been too hard to live since you've gone."

Just then, Claire remembered what her grandfather told her about the machine. It let someone find out how they would die but from the mouth of the person you loved most! She also remembered the words of his letter that said if she were to use the machine, she would have to hear how she would die. She knew it would be her grandfather who would said those words. She knew it in her blood. But did she want to know how she would die? The question nibbled at her mind for a long time. There was still some small hope that she could beat the cancer but Claire was tired of hoping. She wanted to see her grandfather again, to feel his love deep in her blood again, but she was afraid that she forgot how to feel. Her blood had stopped talking a long time ago, ever since he died. She imagined that darkness she encountered when she went inward had killed the voice of her blood somehow. She decided she didn’t care. Claire believed she would be dead in a year from the leukemia and chemo. She felt herself getting worse and worse each week, and to her it was only a matter of time.

There was nothing to lose and so the knowledge of how she would die became no great sacrifice. She took the vial from its brass rigging and held it in her right hand and grabbed the small Swiss Army blade on the floor with her left. She remade the wound above her right elbow and fresh blood flowed. Claire relished the pain, the feeling of something for just a moment and with hands trembling she began to catch the blood in the glass vial.

Claire didn't know how much blood was needed, and so she filled it almost to the top. She screwed the glass vial back into its brass rigging, turning it upright, and waited. She didn't know what to do next. There was no button to turn the machine on, it seemed; just the buttons of letters and numbers. But after a few moments there was a sound of a quiet vacuum and the blood emptied from the vial. It flowed through small glass tubing that protruded in separate places from the wood paneling. The paper spindle began to shake and spin and words were typed all on their own:

PLEASE ENTER YOUR FULL NAME:

Claire carefully entered the requested information, using two quivering fingers to peck out her moniker and making sure she made no mistake.

CLAIRE ANNE PETERSON

The machine whirred and buzzed, the paper fed then responded with a new typed message:
HELLO, CLAIRE. I WILL NOW BEGIN TRANSCRIBING YOUR DNA. PLEASE WAIT...
Claire waited. And waited. Nothing. "Maybe it’s broken," she thought to herself. But the machine began typing slowly in front of her.

AGTCGACTGAGAGAAGTCCTCTAGTCTCGACTTCAGA
UACUGCCUAGUCGGCGUUCGCCUUAACCGCUGUAUU

Letters began to flood onto the paper. Letter after letter after letter until the machine was typing so fast that they became a blur. Millions of letters must have been typed, and it seemed there was no end to the ink and paper. Several minutes of this whizzing transcription past when there was a sudden stop to the paper spindle.

DNA TRANSCRIPTION COMPLETE.
PERSONAL DEATH PREDICTION VERIFIED.
DEATH PREDICTION ADVOCATE SELECTION COMPLETE.
FACIAL AND PERSONALITY CONSTRUCTION IN PROCESS
PLEASE WAIT...

For what felt like an eternity, there was complete silence. Claire didn't even notice when the flashlight sputtered out. She was there in the darkness and she began to go inward, fingering the path of blood that was on her right arm. A low click and hum came from the machine as a lens rose out of the top and began emitting a soft blue light. Slowly, small shapes of squares and lines began to grow from the surface of the lens. Claire watched as a face began to take shape before her, much larger than real life. At first, it was just a plain blue face, but lines and dots began to mark the spots of wrinkles, hair, and spectacles that created the face of her grandfather. As if by magic, he was there. Claire recognized every wrinkle and hair, and the face looked down at her with those kind, twinkling eyes. It was the moment she had waited for.

The face spoke, “Hello, Claire.”

#

Claire stared at the fuzzy, pale blue face not knowing what to say. She trembled as a single tear ran down her cheek.

"Grandpa?" Claire said.

The wizened old face blinked and looked down at her, smiling kindly. The face was a deep blue with horizontal static lines running its length with periodic waves that distorted the image. Claire could see each point of the face she missed so much: the long beard and bald head, the bushy eyebrows sticking out from behind the round spectacles, the small mouth that was buried underneath a thick moustache, and his eyes; those kind, gentle loving eyes that she had searched for ever since he died.

She reached out to touch his beard, his wrinkles, his round spectacles but all she could grasp was air. The face of blue lines would only shake and adjust to her fingers, rematerializing after they left the projection of the machine.

"Hello, Claire." The face said again, with all the love and kindness a grandfather could have.

"Grandpa," Claire said between fits of tears, "I've wanted to see you for so long."

"It’s alright now. I'm here."

Claire could no longer contain her grief. She cried there in the attic, kneeling, her knees to her forehead hiding her face. She couldn't stop from shuddering. There were moments when she couldn't breathe but the face from the machine only looked on, the pale blue glow illuminating the room.

She took a deep breath while the tears subsided and her body stopped convulsing. "Why did you leave, grandpa? Why did you go when I needed you most? If you knew when you were supposed to die, why didn’t you try to stop it?"

"I'm sorry, my love." The face said, "I would have stayed forever if it meant to save you pain. But I had no say in the matter. I could not have stopped my death any more than I could stop the rising of the sun.”

"I need you here with me." She cried again.

"I am here with you, my beloved child. I am always with you."

"It’s not the same," she protested, "I need to see you here, to feel you here. I've needed to hold you for so many years but you weren't there."

"I was there, just not in the same way as before. I've watched every tear you've cried, heard every scream you've yelled, felt every cut you've made."

Claire instinctively covered her arms. She told no one about her cutting and there was no one yet to question the marks. She found herself embarrassed and ashamed.

"You do not need to hide from me, child. I know the loneliness you've felt. The yearning you've had for it all to end."

"I just want to die..."

"I know. It's been so hard for you. I wish I can take your pain away but it is yours to bear."
Claire sniffed and avoided his eyes. "So am I going to die?"

The blue face stared at her. It did not answer right away and Claire was beginning to think it was broken somehow.

Just before the silence became unbearable, the face spoke, "Everyone dies someday, Claire. What matters is not how or when we die, but whether or not we die well."

"And how does someone die well?" Claire asked.

"By living well," the face replied, "Sharing love, confronting fear, making peace, helping others... these ideas are simple but they make living and dying all the more easier."

Claire shook her head, "It’s too much. It’s all too much... I can't stand it anymore..."

The face said nothing. Claire began to cry again.

"This is your story," the face said, "No one can tell it but you. While the tragedies that happen to us may or may not be set in stone we still have the choice to either be defeated by them or to grow from them."

"And what if we can't grow?" Claire asked, "What if we just die?"

"Death is only another opportunity to grow, dear child. I should know," the face smiled, "With each moment I tried to leave this world with a little more love than when I found it. Even to my dying breath I thought about how grateful I was to have you in my life."

Claire wept again. She felt as though all she was were tears now. “I think I just forget how to live, ever since you died.”

"I know, Claire," the face paused, "My time is almost up. How do you believe you will die?"

Claire wiped away her tears, "Cancer." It had become a word she spoke too often, a word she had become too familiar with.

“Then that is how you will die, Claire.” The face spoke with a sigh, “If you give up, if you choose to be defined by your disease then that is what will claim your life. In fact, if that is your choice, then it already has.”

“I don’t care anymore.”

“Tell the truth, Claire. I know you better than that.”

"Why does it even matter?"

The face grew stern, "It is the only thing that matters. You have the power to choose what your life means. Search deep down, Claire. What is your blood telling you?"

Claire closed her eyes and tried hear herself. Despite her fear, she went inward and confronted the terrible pain that she had been running from for years. But instead of it swallowing her whole, it whispered to her. It was her inner voice, her blood. What she had thought she had lost and forgotten was there all along, alone in the darkness of her deepest self. Instead of running, she chose to listen. "My blood... My blood wants to live."

"Good. I’m glad you can finally hear it again." The face smiled at her.

It was then that Claire didn't feel like crying anymore, "Thank you, grandpa."

"You're welcome, dear girl."

Claire stood and rubbed her arms. The blood had dried and her scars were visible, but she didn't feel like hiding them anymore.

"There's one more thing, Claire," the blue face said.

"What is it?"

"I have to give my prediction."

"But I thought cancer was..."

"That is what you predicted. Now I must give you mine."

Claire held her breath. The blood flood through the glass vacuum of the machine and the blue face looked at her with piercing eyes. Just moments before, Claire didn't care if she lived to the end of that conversation, but she could not deny, deep down, deep in her blood was a small glimmer of hope at life beyond cancer.

The face was silent and thoughtful but the paper on the machine was busy spinning away. It typed a single line of text and cut the sliver loose. It fell to the floor before Claire’s feet.

She read: 80th BIRTHDAY CAKE

“Well, isn’t that curious? Just as bewildering as my own prediction…”

Claire smiled for the first time since her grandfather died. She felt that old feeling of warmth deep in her blood. Her mind was racing past all the people she might know who were close to becoming 80 years old but she stopped herself and began laughing.

"I suppose it doesn't really matter." She said.

The face laughed too, "No, it doesn't. What matters is how you share your love with the time you have. Remember that, Claire." The blue lines that made the face were beginning to wave and static. He was fading away.

"What's it like to die, grandpa?” She asked before he was gone.

"It isn't as bad as most people fear. And there are so many wonders to see after!" The face fizzled down to bits of dots and lines. The bright blue glow grew dimmer and dimmer until there was nothing left.

"Goodbye, grandpa."

Claire grabbed the flashlight and hit it once. The light flickered on and Claire crawled down the attic steps, leaving behind the machine and the Swiss Army knife but taking hope with her.

The Lake

2011-11-28T10:16:00.002-05:00

The lake was clear that morning. The dark greens of the sand and dirt below the water shifted and clouded each time Desmond took a new step. The minnows schooled around his ankles as he waded through the shallows. The canoe was giving him a hard time that morning, scuffing against the rocks while he was pulling it into the lake. Desmond remembered it being easier to move last time. Desmond was also twenty years younger last time.

He had already tripped once getting the canoe through the landing and his overalls were soaked up to his chest, but Desmond was determined. His life kept him away from the lake for the better part of two decades and he'd be damned if he didn't find some time to spend out on the water now. Once deep, the canoe cut through the murky tarn like a knife through jelly. He jumped into the boat and paddled out. Not a soul was around. The lake was still save for his lone oar tapping the water.

It wasn't until he paddled out for about a half an hour that Desmond realized he forgot his rod. He looked behind his tackle box hoping it might be somewhere in the canoe anyway. It wasn't. It was back on shore in the back of his truck.

"Goddammit."

He was forgetting things more and more. Small things at first, but then bigger things. Small things like grocery lists and telephone numbers. Bigger things like how it was wrong to hit your wife.

She left him a little over a week ago. Or maybe it was a month ago. Time took a strange turn once she left. Desmond couldn't remember what the fight was over. She took Annabel with her and moved in across town with her sister. He didn't like her sister now that he thought about it, but at the time of her storming out he really didn't care where she went. He just wanted her gone. He hated his wife when she left. He hated how their fight ended, how Annabel cried as her mother grabbed her arm, how she even took the dog and stuffed him in the car despite his protests. It wasn't until he forgot his rod out there on the lake that he remembered he loved his wife. On that green water a half hour's paddle from any shore and another forty-five minute’s drive to another living soul, Desmond realized just how alone he was. The thought hit him hard like a hailstone on the head. He slumped into the canoe and covered his face to keep from crying. Covering his face didn't help.

That was when he heard the voice. It was nothing but a whisper in the wind.

"You've come back to me."

Desmond jerked up and looked all around, wiping his eyes and nose on his flannel sleeve. A light mist was beginning to rise from the surface of the water in the cool of morning, but there was nothing else to see. Desmond thought his hearing was starting to go with his memory when he heard the voice again, clearer and louder this time.

"You've been away for so long; I was beginning to think you had forgotten me."

"Who's there?" Desmond yelled.

"It’s me, don't you remember?" A gentle wind caressed Desmond's face. The breeze cooled the skin where his tears had dried.

"Where are you? I don't see you."

"I'm here. And there. And over there. I'm all around you. I'm under you."

Desmond wheeled around trying to follow the direction of the voice. He couldn't pinpoint it but it sounded close. There was no one there. Desmond grasped the side of the canoe and looked over to see if it was a swimmer playing a joke. But there was no one there either. Just his reflection in the water.

A small ripple went through his dark image. Desmond didn't remember looking so old. His hair had turned white, his eyes more sunken and vacant, cavernous wrinkles stretched across his face like deep cuts through thin fabric. Even his lips had affixed into a permanent frown.
"You've grown, Desmond." the voice said.

Desmond took one last look around the lake, hoping to find the reason his heart was beating so fast. "Where are you? Show yourself!"

"Look into the water." The voice answered.

Desmond looked over the canoe again only this time he saw no reflection. There was only a blackness staring back. The water had become dark and opaque and it seemed to drink the light of the sunrise. Desmond could see nothing.

"Look deeper."

Desmond moved his face closer to the dark water and peered just beyond the reach of the illuminating dawn. He thought he could see a form moving in the blackness. It was too big to be a fish and it was whispy, almost like a kind of seaweed or drifting sand. The smell of the water, that green and brown smell filled Desmond's nostrils as he leaned closer and closer to see. The whispy strands floated to the flow of the current and then suddenly revealed a face; cold, lifeless, and dark except for the pale white orbs that were its eyes staring straight into Desmond's. He fell back in the canoe at the sight, clutching the side of the boat with one hand and his chest with the other. He let out a small grunt that was meant to be a scream but the sound caught somewhere just beneath his ribs.

"Do not be afraid, Desmond," the voice whispered, "It is good to see your face once more."
Desmond was panting but his heartbeat slowed. At first he thought he was going into arrest but he then realized there was something strangely comforting about that voice. Something familiar. The cool air off the lake filled his lungs as he breathed heavy. It was an odd feeling of nostalgia, the sweat on his forehead mixed with the mist around the canoe and it was as if he was remembering something from a distant, forgotten part of his soul.

"Who are you?" he asked, shaking.

"Do you not remember, Desmond? You once called this lake your home. You would play beneath the skin of my water. You would drink from me as a child from his mother's breast. You would whisper secrets to me and they would ripple to my heart. We shared our pains, our joys, and our sorrows were lighter when you were with me."

The memories came crashing into Desmond's mind like a wave. He remembered at the young age of six, skipping rocks across the lake and speaking to someone far away. He remembered at seven diving deep into the darkness of the lake trying to reach the bottom. He would reach out to touch the dirt at the basin and instead would feel a hand reach back, cold fingers grasping at his own. He remembered countless early mornings just before dusk wading through the shallows and hearing distant sighs of someone in ecstasy as his feet mingled with the mud and minnows. Then he remembered the woman.

"I do remember! I was... I was just five years old. You saved me. I was drowning. Nobody saw me fall and I couldn't find the surface. But you found me. You found me and gave me air, didn't you? You... you kissed me and gave me a chance to breathe."

"... Yes." The voice sounded full of relief. Slowly Desmond crept to the side of the canoe and again looked into the deep. The face was still there but with eyes closed. She appeared to be crying as small bubbles of air collected around the corners of her eyes and floated to the surface.

"I do remember. Thank you."

She did not respond.

"But... what are you?"

"I am the lake. The lake is me." The voice spoke but the lips of the woman did not move. Desmond looked mesmerized into the pale eyes of the face that looked back. Green stands of light darted across her features as the reflection of the morning sun brightened the waters around her skin. "I am very old, Desmond. This lake is my home and my coffin. I died here a long, long time ago. I've longed to see your face again, to hear your secrets again, to be with you once more. I saw your tears, Desmond. Tell me, what troubles your heart?"

"A woman," he said. "A woman I loved has left me."

"For someone you love to leave you... that is the hardest pain."

Desmond could feel the tears well in his own eyes, "I've never felt this terrible." He wiped his nose on his flannel sleeve again, the hardened crust of his previous wipe stinging his reddened nostrils. He sniffed hard feeling the cool lake air fill him once again, "I want her back more than anything."

"Do you still love her?"

"Yes."

"Even after she hurt you this way?"

"Yes."

For a while the voice said nothing.

Then the lake trembled. Ripples rose around the canoe and he saw the sliver of fingers break the surface of the water. After the fingers came an arm, then a raven black mass of hair, a pale dark face, thin shoulders, and a small pair of breasts that glistened as the water melted from them. The woman leaned her arms on the side of the canoe and her hair tangled over her shoulders dripping the lake into the boat. Desmond smelled the water, the fish, the seaweed, and the woman. It was the same smell that entered his nose at five when he was drowning and breathing the lake and scared to lose his life.

The woman stared at Desmond with a new set of eyes. Beautiful, dark brown eyes that Desmond could not look away from.

"I will help you, Desmond." The woman spoke from her own lips, "This lake has secrets, too, and I've learned how to use them over my many years beneath its surface."

"You're going to help me get her back?"

"That is for the lake to decide." She looked away as if to recall some distant memory. "The lake will hear your desires and make judgment. But it will help you find what you seek."

The lake had begun to fog, and before Desmond realized he was surrounded in white mist. The canoe lapped at the surface of the water and the ripples went as far as he could see but the shore was now hidden from view. All he could see was the water and the woman.

"I need her back. I need her. I've got nothing without her or my daughter. She'll take everything from me for what I've done."

"Your worries will soon be over, Desmond." The woman climbed into the canoe. Desmond stood to prevent it from tipping but he felt no rock to the boat as she entered; it was as if the woman were weightless. She floated close to him and embraced him, the wet from her arms and breasts soaking into his overalls and flannel shirt. He felt the cold chill of the lake touch his skin and he closed his eyes.

"How can I get her back?" he asked.

Suddenly, the canoe hit rock. Desmond toppled and fell to the floor of the boat. He saw that he had somehow drifted to shore. He turned back to look across the fog covered lake. The woman was gone. But he heard the voice one last time.

"Come back tomorrow at sunset and you will have your answer."

______________________________

"You must do exactly as I say, Desmond."

He was standing in the canoe in the center of the lake. A chill wind stung his eyes. The woman was nowhere to be seen, but her voice spoke with a clear conviction.
"Beside you in the water, you will find a knife made of bone."

Desmond looked and floating there was a shaft of pale white like the spine of a dead fish. Desmond lifted the knife from the water as a small stream of mud and ooze loosed from crevices and holes in the hilt. Desmond examined the blade. It was thin and brittle with one edge sharpened. He touched it lightly to his finger and felt small jagged spikes that stuck to his skin.

"Cut open a wound in your hand."

Desmond looked around him, startled.

"You must do this, Desmond. The lake must taste of your blood to tell you your secret."
Slowly, Desmond lifted the blade to his open palm and stretched his arms over the water. With a quick stroke the jagged edge of the knife bit through his skin and he could feel the dew on the blade enter his blood. It was cold.

A steady river of red poured from the wound and trickled from his wrist into the water below. Desmond watched as the deep red droplets fell, mixing with the orange of the twilight sky and then the dark green of the lake. Swirls of steam hissed as more drops touched the surface of the water, and a gentle bubbling belied some movement underneath the surface.

"Now what?" Desmond asked.

"Now you wait," the woman replied, "You will receive your answer soon."

Desmond sat in the canoe and ripped part of his flannel sleeve from his shirt. He placed the jagged bone knife down and dabbed at the blood in his hand. The wound went deeper than Desmond had intended. He wrapped the cloth around the cut and tied it with his remaining hand and teeth.

"There," came the soft voice, "Your secret."

Amidst the greens and reds mingled in the lake came a small beige scrap of paper. Desmond leaned and lifted the soaking slip and held it with both hands. He gazed at the four small words.

IN HER LOVING ARMS

"I don't understand." He said, "What does this mean?"

"That is how you will die, Desmond."

"How I will die?" he could feel his blood beginning to race, "What do you mean how I'll die?"

"This lake is a special place, Desmond. The veil between life and afterlife is thin, especially here. The lake sees things. The lake hears things... it hears the cries and desires of all who come near. This lake took my life once, but out of pity. It took my life so that it could help others who've experienced the terrible pain of losing someone you love."

"But how does telling me how I will die help me get Irene back?"

"Read the words again, Desmond. See the phrase? See the meaning behind the words? You will die in the arms of a woman who loves you."

"But it could be any woman, couldn't it?"

"That could only be true if any woman could fall in love with you."

Desmond felt his heart skip a beat. There was only one woman in his life who ever truly loved him, and he knew it. Irene.

___________________________

The rain was falling hard and the mud at Desmond's feet was giving way to the hard stone underneath. He tried to shake off some of the grime but it clung to his soles like fleas on a dog. He pounded on the door one more time.

"Irene, you're not listening to me!"

"I'm listening to you, Des, and I'm telling you you're crazy." A voice inside was muffled by wood and vinyl paneling.

"You can't fight fate, Irene! I know how this ends and you'll come back to me!" Desmond kicked at the door and a bloodhound jumped at the window on the other side. His mouth frothed with white foam from all his barking. Desmond stepped back, surprised that his own hound didn't seem to recognize him. He put his wide brim hat back on and strode slowly to his truck, wet and angry. He climbed inside and wiped the rain from his face with his handkerchief. He didn't notice Annabel in the seat next to him.

"Are the things mom saying true?" she asked quietly.

"God almighty!" Desmond startled. She sat with her legs crossed, twisting the bone knife in her hands. "Annabel, you can't creep around like this. Does your momma know you're out here?"

She shook her head. Her dress and hair were wet with rain.

Desmond sighed and reached into the back seat and pulled out an old woolen blanket. It was stiff and scratchy but warm and Annabel pulled it tight around her.

"Now, what's your mother been saying about me?"

"Bad things, daddy. She says you're a no-good devil, and that you'd run out on us first the chance you get."

"Now darlin' you know that's not true."

"She's says you've been running around with Ms. Thompson from the general store. She says she saw you being too friendly with her."

"That's a bold-faced lie." Desmond said, a little too loudly. Annabel didn't have a response.
"Your mom and I have had some hard times. I might've said some things I shouldn't have said. Might've been a bit too hard on her. Never should have struck her." He sighed. "But I love your mother. She's my wife, and I promised I'd take care of the both of you. I know I'm going to win her back someday."

"She hates you, daddy. She says she's always hated you." Annabel said sadly, "What makes you so sure she'll take you back?"

"I've seen the words, Anna. I know how I'm gonna die. It might be tomorrow and it might be in a hundred years, but I'm gonna die with that woman by my side. My secret said I'd die in her arms."

"Did it say it'd be mom?"

"It said that those arms would be loving, and I don't know of any other woman to love me other than her."

"But how do you know it won't be some other woman? Christ, how do you know it won't be in my arms?"

"You watch your mouth, Anna. I don't wanna hear any more blasphemy." She turned away and watched the rain outside. Desmond wiped the brow under his hat, "I suppose I don't know, not truly. All I know is that you and your mom are the only things I've loved in this life and you two are the only things that have ever loved me. I suppose it’s got to be one or the other that I die with. And I suppose that isn't so bad, the more I think about it." He leaned over and kissed her on the forehead.

"I don't want you to die, daddy. I don't want you to leave either." She had tears, "I just want everything back the way it was."

"It will be, darlin'. It will be. I promise you." Desmond started the truck and shifted it into gear. "How's about we let your momma cool off a bit and we go get something to eat?"
"Not right now, daddy." Annabel opened the truck door and stepped out into the rain, still clinging to the woolen blanket. She turned to face him, "You never should have hit her." The door slammed shut with a high-pitched creak and clang. He watched her walk through the mud and wet back to the house. Desmond sat there a long time, his foot pressed to the brake. After a while, the rain stopped as if waiting for something to be said. The sun had set and the lights in the house had gone dark before Desmond turned his headlights on and began the long drive home.

_______________________

"You get out. I don't want anything to do with you." Irene was busy adjusting the table lamp and drapes. She tried not to notice when Desmond walked into the living room.
"Just hear me out, Irene." Desmond started.

"You don't have anything I want to hear. We're through. Was it Annabel that let you in?"

"Damn it, Irene, we're not through! Just listen to me."

"No, you listen to me!" she turned to face him square in the face, "For twenty years we've been married and you never once raised a hand against me in spite. But as soon as I catch you talking to that pretty little thing in town you seem to get it into your head that you want something more. Well, you go and have you're little fun, Desmond. But I'm gone. And I'm taking Annabel."

"You've gone insane, woman. I've never cheated on you and never would."

The sun came in through the windows like a stranger looking in. It hit the floor in a checked pattern that brightened the greens and reds on Irene's flowery shoes.

"I don't care if you did or didn't," she said, "I want you out of my life and out of my home. I'm not about to risk you striking Annabel."

"Irene, I would never..."

"I'm seeing someone else." She said suddenly, "I spent over twenty damn years of my life with you and all it got me was a headstrong daughter and a black eye. You're worthless and I'm not about to waste any more time with you."

The words cut Desmond like a bullet through the chest. The sunlight was on her face now and he could see the wrinkles on her brow. She seemed older than he had ever noticed at that moment. The sadness and distance in her eyes were more than he could bear. He looked away.
"Who is he?" he asked. It was all he could think to say.

"Never you mind who he is." She said, returning to the lamp and drapes, "He makes good money and he treats me kindly, that's all that matters."

Desmond was too angry to cry. His fists balled. He was tempted to hit her again. Was this how the lake worked its magic?

"Tell me his name."

"I'll do no such thing. I think it’s about time you left, Des. I don't want to see your face again."

"You'll tell me his name!" He grabbed her by the shoulders and shook. He didn't think it was hard, but she gasped in pain. She slapped him twice but he caught her hand at the third swing. He put fingers to his lip and felt blood seeping down his chin. In anger he pulled a fist back and aimed to make another black eye. It was a voice that stopped him.

"Daddy?" Desmond heard Annabel from the stairs. She had crept in and was seated on the topmost step, looking down into the living room.

"Annabel..."

"You said you would never hit her again."

"I know, and I meant it." He let go of Irene.

"Then what were you going to do just now?"

Desmond knew he was caught. Irene smiled a wicked smile at a criminal who had just been convicted.

"See what I told you, Annabel? He'll just hurt us again if we stick around."

"You shut your mouth. You've got no business running around with another man. Dammit, I'm still your husband."

"You're no husband of mine," she laughed, "Get your things, Annabel. We're leaving."

Annabel had already disappeared from the step and she was heard crying upstairs. Once he knew she was out of sight Desmond grabbed Irene and pulled her close.

"You've poisoned her against me." He spat as he spoke.

"It wasn't hard to do. It seems she already knew what kind of man you are." She wretched free from his grip and walked upstairs. Desmond could hear her soothing coos and whispers in Annabel's ear. He sat in the easy chair with the white linen cloths spread on the armrests and stared out the window with the checkered pattern drapes. It was raining again and lightning began to flash through the windowpane.

After a few minutes Irene came stomping down the stairs with two suitcases and a bright red straw hat. Annabel followed her down more slowly and the dog took up the rear with tail wagging as if nothing was wrong.

"We're leaving, Desmond. I'm not telling you where we're going this time," Desmond thought she almost sounded cheerful, "Don't try to find us. I've told the police everything and they'll hunt you down if you try any funny business."

Desmond tried to talk but couldn't. His life was crumbling around him and all he could do was watch Irene's flowery shoes as they stepped in and out of the lightning flashes on the floor.
"Nothing to say now, hmm? Well, I suppose guilt would silence any man from time to time. Come along, Annabel. We have a long drive ahead of us."

Desmond looked to Annabel as they walked to the door. For a brief moment she looked back. "You promised." It was all she could say as tears dripped on either side of her mouth. Irene pushed her through the door into the rain and the dog ran passed them, barking.
"Des, dear, you look terrible. You have blood all over your overalls." She gave one last smirk and slammed the door. Desmond looked at his chest and saw that a few drops of blood from his mouth had reached his front pocket. He tried to wipe away the stain but it had already dried and he only smeared the red in deeper. He looked out to see Annabel and the dog jump into the backseat of the sedan. Irene threw the suitcases into the passenger side, slammed the driver's door and in three seconds she started the car and skidded off. He knew then it was over.

____________________

Desmond stood in the middle of the canoe out at the center of the lake. He stood looking out at the mist in the early morning hours wondering how everything got so bad. He still had his bloodstain on his overalls. The pain had subsided and the bleeding had stopped, but the horror was now full in his mind. He had no idea how long he stayed in that easy chair, but his wife and his daughter never came back. It felt as though he were dreaming. He couldn't tell if he was there in that easy chair for only a few minutes or for days. The weather outside the window had never seemed to change and he could only hear the last two words from Annabel's mouth, "You promised." All he remembered was that one moment he stood up from that chair and knew he had to come back to the lake. Desmond looked at his reflection in the water and he saw that he had become ancient.

"You've come back to me." the quiet voice said. Desmond looked into the lake to see the woman, pale black skin and white bulging eyes.

"You lied to me."

"The lake never lies, Desmond."

"They're gone. Irene's gone. And Annabel."

"I know how hard it is to lose a child."

"I loved her. I loved them both." Desmond's eyes were filling.

"I know you did. But they left you. They both left you."

A calm wind pushed at Desmond's back. He could feel the breeze like soft fingers stroking his hair. The woman rose partly out of the water, looking up to his face with those changed, beautiful eyes.

"I will never leave you.” She said, “I loved you, too. I promise."

Desmond looked into her eyes, now brown and deep. "You promise?" She opened her arms wide and Desmond pitched forward into them, numb. She embraced him as they sank below the surface of the lake. She kissed him for the second time in his life and water from her lips filled his mouth. It was the sweetest thing he had ever tasted. Her first kiss gave him life. Her second took it from him. Desmond felt the cold water soak his overalls, flannel, skin, and lungs. As his life began to leave him, Desmond’s last thought was of Annabel and how different her arms would have felt.

The Test

2011-08-09T21:03:00.002-04:00

Tydus entered the stone hall with a heavy sigh. His feet goose-stepped and echoed off the hard walls sounding like a leak in the roof after a hard rain. He collapsed into a heap onto one of the wooden benches. The chainmail he wore seemed heavier, and the sword at his side stuck out at odd angle and its tip hit the floor when he slumped. The golden hilt jabbed into his ribs hard. Tydus winced and leaned his head against the stone wall a little too hard.

“What seems to be the matter, dear boy?”

Madam Sarai’s voice was sweet to the ears. Tydus had not even heard her steps in the hall. He stood with a jolt at attention. The Madam giggled.

“You don’t need to be so formal with me, Tydus.” She brushed a hand against his arm. “Tell me what has you looking so depressed.”

“Madam…” Tydus stammered, “I failed a Test of Courage today.” He looked to the ground when he said this. He noticed that Madam Sarai was not wearing any shoes. She was returning from her rituals.

“Oh, poor dear,” she said with a motherly tone, “Sit and tell me all about it.”

Tydus returned to the bench and the Madam sat next to him, taking his hand in hers. She was forty years his senior but Tydus still felt nervous when she acted so familiar. His voice cracked as he spoke.

“It was in town. I was with the princess, serving as one of her guard as she was out purchasing produce and food for the evening meal. It was at one of the stalls that I saw a man and a woman quarreling. They were clearly upset and they’re voices kept getting louder and louder. I don’t remember what they were yelling about but the man said something and the woman got all red in the face and began to walk away. She had long blond hair all in a braid and it slapped the man’s face with a snap as she turned away from him. She got a few long steps away, but the man rushed forward and grabbed her hair, almost pulling her to the ground. She let out a yell and he grabbed her arm as she tried to hit him. I felt so angry watching him hold her, and everyone could see she was in pain. But I just stood there and watched. I didn’t do anything to stop him. The princess returned and I took one last look at the fighting couple. His hand was gripping her wrist so hard that she was beginning to sink to the ground. But I just followed the princess away from the shop and didn’t look back. It was then that a voice shouted my name, ‘Tydus!’ I turned and it was Master Gaemon. I couldn’t tell at first because he was in disguise, but the quarreling man was Master Gaemon, there was no doubt. ‘You failed, boy.’ Was all he said, and he and the woman disappeared into the crowd.”

“Oh, you poor lad…” Madam Sarai patted his hand, “I wouldn’t fret over it. Most knights fail their first Test of Courage, especially one so hard to recognize.”

“Its a knight’s duty to protect those who cannot protect themselves, Madam.” Came Master Gaemon’s voice from the end of the hall. Tydus shot up from the bench again, only this time he stood too quickly and knocked Madam Sarai to the floor next to him. Torn between the decision to be at attention or to help the old woman off the ground, Tydus did neither, only looked back and forth between Madam Sarai and Master Gaemon.

“For God’s sake, can you do nothing right, boy?” Master Gaemon moved forward and helped the Madam from the floor.

“Don’t be so hard on him, Master Gaemon. It sounds as though he’s been through enough today.” The Madam had one hand on her back and one hand on Gaemon’s arm as she struggled to rise.

“I’ve said it from the beginning, Madam. I don’t need any boys for the Order of the Shield. I need men.”

“Give him a bit of time, and he’ll be a man, Master. He clearly as the heart.”

“Maybe so, but it takes more than a heart to make a man.” He gave a solemn look to Tydus, “I’ve seen too many men torn asunder to know that much. There’s stomach and strength that’s needed as well.”

“He’ll do better next time, I can assure you.” She smiled and patted his cheek as she walked by.

“Not with all your coddling, he won’t. Why do you think its taking these boys so long to become men, eh? You’ve spoiled them as if they were your own children.”

“All of the Order are my children, Master, even you.” She said with a wag of her finger. Her soft feet patted against the cold stone and then she was gone. Master Gaemon shrugged and turned to Tydus.

“Come on, lad. You’ve got work to do.”

“What would you have of me, Master?” asked Tydus, still shivering at attention.

“That woman you failed to help today has some chores for you. Since you failed the test, it is now your duty to seek her out and work for her for a week. Do anything she says, not matter how degrading, do you understand? Its as much a punishment as it is a lesson. And I warn you, she can be as mean as a bitch in heat. I expect she’ll work you to the bone.”

“Yes, Master.”

“Good. Now go. I expect better next time.”

Tydus ran out the hall, his mail and sword jingling with each step.

“God help us all if its boys like him that stand between us and the Mangs.”

Master Gaemon shook his head and walked to the courtyard. The moon was full that evening and he could hear the crickets in the forest to the north. It was a calm and cool evening, the perfect invitation for some meditation. Gaemon realized it had been days since he had experienced gnomite. It wasn't any wonder he felt out of balance during the Test today. He sat down with folded legs and open hands in the small patch of grass and bathed himself in the moonlight and sounds of the evening. He closed his eyes and slowly began to breath through his nose, focusing on the the sensations around him and within him, the beginning stages of gnomite. Faintly, the sounds began to be more distant and the sensations on his skin and hair seemed more intense. He began to feel the air as it entered his lungs, the blood as it passed from his heart through his veins, his muscles as each fiber contracted and relaxed. He cleared his mind of all thought and entered gnomite, the place of All-Being. It was there that he first discovered his own Courage and the source of his Strength. He breathed deep and allowed himself to sink into the All-Being, becoming almost nothing in the vastness of existence. Gaemon slipped out of time and place and felt at one with the world around him. Not just the courtyard and castle, but the whole kingdom. He could feel his spirit stretch across the land like the great sky overhead. He could hear the distant voices of men speaking in whispers in places unseen. He could feel the heat of Hatred coming from some far-off place but it was too far to see or grasp. Suddenly, like a bolt of lightning, a scream came from the tower above the courtyard. Gaemon broke his gnomite with a gasp. It took a moment for him to gather all his senses but then he was filled with a sense of dread. The scream came from the royal tower, from what sounded like the princess’s bedchamber. In a single bound Master Gaemon was off, bolting through corridors and passages, praying his brief negligence wouldn't be the end of the realm.

Ancestors, Pt. 3

2011-06-08T16:11:00.002-04:00

“It’s terrible.” Charles said, “Complete garbage. You have more spelling errors than I care to count. Not to mention your punctuation…”

Charles threw the papers down onto the cafe table and small pastry crumbs leaped up and down on their plates. The bright afternoon sun formed solid shadows of the tree along the street. Emith and his brother sat beneath the shade of a large oak attempting to enjoy an afternoon brunch of fruit pastries and tea. Charles was taking time off work. Emith had no work to speak refrain from.

Emith sipped his tea gingerly as he collected the stack of papers that were his newest work. “Of course its terrible,” Emith said, “Its a first draft. And I do not recall asking you to be my editor. I asked you for your opinion of the content.”

“I didn't like that any better,” Charles said, sipping on a hot cup of Earl Grey, “The bit about the woman in red was the only interesting part so far, and even that lacked a certain dénouement.”

“I believe you fail to grasp the nuances of that word, Charles” Emith replied, rubbing his temples to prevent the oncoming headache, “Specifically, you don’t know the bloody definition!”

“No reason to be crude, brother,” Charles said, “It just needs work is all. It has no punch, no hook, nothing to keep the reader interested.”

“I don’t even know why I bother asking you. The last thing you read was some horror novella from that disreputable rag you insist on subscribing to.”

“The New Town Suspense Monthly is a legitimate publication. You should consider writing something for them. I’m sure if you put your creative energies into writing something with a bit more excitement you’d do well. I could even put in a word for you with the editor.”

“What, are they doing so terribly that they need writing suggestions from their legions of subscribers?”

“Don’t be cocky, Emith. It just so happens that he lives in the flat next door to mine.”

Emith laughed, “Of course he does.”

Emith took a bite of a small rasberry pastry. The filling oozed out of the opposite end onto his unguarded hand, the sticky sweetness clinging to the skin and hair. Emith cursed. He knew his hand would feel sticky all day now regardless of how often he washed it. How could such a small thing remind a person that everything has gone wrong?

“Some days you make a terrible brother, Charlie,” Emith said.

Charlie smiled, “Is this because I’m mother’s favorite?” Charlie tore a piece of his biscuit off and threw it at Emith’s face. It bounced off his cheek and landed in his tea.

“I’m actually at peace with that, Charles.” Emith responded, wiping his face, “Mother has often said that I couldn’t be more different than either of you. I used to question the wisdom of a god that would place me in a family such as this but I've resigned to the truth.”

Charles cocked his head, "That god's wisdom cannot be understood?"

"No," Emith replied, "That there is no god."

“You’re a strange one, Emith.” Charles laughed, “Even before father died, you were different.” He took a large bite from his biscuit, “Father coddled you,” he said between chews, crumbs spraying out of his mouth, “That’s why you turned out the way you did.”

Emith stared at him, “And what is that supposed to mean, Charles?”

Charles swallowed, “Don’t be daft, brother.”

Emith could feel his anger rising, “Humor me, Charlie. I want you to speak what you mean.”

Charles sighed and put down his biscuit, “Well, Em, where should I begin? You’ve got no job, no wife, no children, you’re being evicted from your apartment, and you're constantly pestering mother for money and advances. Your last success as a writer was years ago, and even that wasn’t a good one. It’s time to give up this cloud-chasing and act like an adult. Get a real job. Settle down. Anyone who knows you for more than moment can see that you’re a failure in almost any respect.”

Those last words were too much. Emith stood straight up, knocking the chair beneath him to the floor. The cafe patio patrons stopped as if on cue and stared right at him.

“I see,” he began, “I knew you always had a low opinion of me, dear brother, I just never knew it was this low.”

“Oh, stop being so dramatic and sit down. People are staring.”

“No, I don’t think I will join you any longer. I find myself suddenly lacking an appetite and empty of any desire to continue conversation with you. Good day.”

Emith grabbed his coat and hat. He was gone from the cafe patio in two strides with his brother calling behind. But Charles made no move to stop him.

Emith was tired, worn, hungry, and desperate. As much as Charles may have been right what hurt most is that the truth had to come from Charles. The golden boy, the one that grew up, the one that gave the grandkids and the money and the pride… He was everything that Emith was not. For his entire life, Emith only wanted to write. And for years he did and he was happy. But Emith was also uncompromising. He wrote what he wanted to, not what others told him to. That cost him many a newspaper column.

Emith’s anger raged and his mind raced through the downward spiral of self-deprication. Story after story, memory after memory played through his mind’s eye, each a remainder of Charles word, ‘failure.’

After a brief bout of suicidal ideation while crossing the pedestrian bridge over the Chicago River, Emith somehow found himself in front of his mother’s flat. Absently, he knocked on her door.

“Emith?” she answered, “What’s wrong?” She had the charm of an anxious mother at that moment.

“Am I a failure?”

“Oh, dear…” she wrapped he small arms around her son’s neck. After a brief moment of respite her wrinkled face looked up into his eyes and sweetly replied, “Of course you are.”

Emith was dumbstruck. “Thank you for your honesty," he mumbled, "I’ll be taking my leave.”

“You’ll do no such thing,” she grabbed his sleeve as he turned, “besides, there’s something I wanted to show you. I think you’ll like it. It may be just what you're looking for.”

She lead him into her living room amidst the ticks and tocks of countless wall clocks, “You really shouldn’t be so surprised,” she said as they sat on her velvet couch, “Anyone who sees you can tell you have yet to amount to much.”

“Charles said a very similar thing,” Emith said.

“Oh, pay no attention to Charles. True, he’s made a bit of himself but he’s always been jealous of your father’s love. You were always his favorite.”

“And Charles is yours?”

“I love both my boys equally,” she said, “Besides, he's much too prideful. Just don’t tell him I told you so. Here.”

She handed him a large shoebox. It was heavy to hold and felt as though it was filled with books. “What is it?” Emith asked.

“I found this cleaning up in the attic. Its the closest thing we have to family heirlooms.”

Emith opened the box and saw newspaper clippings, old photos, bits of stones, a small engraven plaque, letters still sealed in their envelopes, and many other items. It was a treasure trove of history dating back years and years.

“Who collected all this?” he asked

“Oh, several of your ancestors. I believe it was your great-great-great-grandmother that began collecting things. She kept all the things that were important to her and her husband at the time, and her children. There’s things in there dating back to the mid 1800’s when our family first came to this country. Many descendants since then have been putting small important things in there for generations. The last I saw of it was shortly after you were born. I think I placed a picture of you and your brother in there.”

Looking through, Emith saw early pictures of his parents, engravings of his grandmother, writings of his grandfather, the picture of himself and Charles… all things he had never seen before.

“I thought some of this might inspire you to write something new.” His mother said.

“Its beautiful,” Emith said, “There’s so much here, so much I don’t even know…”

“Emith…” she took his hand, “I know you’ve felt… different your whole life. To be honest, this family wasn’t quite a good fit for you. Your father died too early and you lost all connection with your brother and I.”

Emith began to speak but she stopped him, “I can’t give you what you’re looking for. I love you dearly, but I don’t understand you. I can’t, and you need someone who does. I worry sometimes that you won’t find anyone who can.”

Emith blushed. Her words were all true. He felt like he needed to apologize but he didn’t know what to be sorry for. His eyes avoided hers in shame. Instead he looked to the shoebox of heirlooms and glimpsed an old engraving at the bottom of the box. For a brief moment the world stood still and Emith gasped.

“Mother… who is this?” Emith asked.

“That? I believe that may be your great-great-great-grandmother," she replied, counting the 'greats' off on her fingers, "I never knew her myself; I understand she died quite young but she was the one that started this box.”

Emith took the engraving out to see more clearly, but his heart was beating as if it were going to stop at any moment.

“She’s quite beautiful, isn’t she? I like to think I took after her looks in my younger years.”

“Y… Yes.” Emith stuttered. His world was turned upside down, and he could not think clearly. There, engraved before him, was the woman in red. It was not a colored engraving but the straw hat, the dress, the face, the smile were all unmistakable. The woman he met at the cafe who claimed to know him, who claimed to be dead was staring back at him from that ancient engraving with the same look of joy on her face. It was that look that almost made him fall in love with her.

“Emith, dear are you feeling well? You’re all pale… you look as though you’ve seen a ghost!”

Emith swallowed hard. His throat was dry and he was feeliing dizzy, “I think I may have, mother. I think I have.”

The Rains

2011-05-25T21:34:00.001-04:00

The fields were hot that afternoon. The hands breathed heavily like dogs panting from too much rabbit chasing. Cara stood and shielded her eyes against the suns. In the bright blue sky she could see dark, grey masses billow and flashing in the distance. She cursed. The harvest had come too late that year.

“Cara! Come inside! The Rains will be here soon!” her sister yelled.

“I see it,” Cara said, “We still have some time. Get the lesser hands into shelter and make sure the windows are bolted.”

Several of the fieldhands took their great baskets filled to the brim with ambrosia and began the long slow journey to the huts at the edge of the meadows. The gods had hoped to feast that evening to celebrate the end of yet another peaceful season but the supply of ambrosia had been sparse. This was only the second harvest of the spring months and the Rains had come early.

Cara cursed again and picked the fruits with greater energy. At least she could work her hardest; the gods could not deny her that. The sounds of rolling thunder galloped across the vast meadows like a band of horses, herlading the oncoming storm. Once th Rains reached the ambrosia fields the crop would be lost, and they must wait another two months before they could harvest again.

“Why must they come so soon this year?” Cara asked herself.

A voice from behind her responded, “Because the world is changing. Didn’t anyone tell you that?”

A pair of hands wrapped themsleves around Cara’s slender waist and hoisted her off the ground in one great motion. Cara let out a yelp and began beating her fists against the hands that held her. “Let me down, Farian. I don’t have time for this!”

“Oh, you never have time for a little jest! Maybe some play would do you some good!” Farian said as he whirled her around in fast circles. He set her back down, and Cara dizzily took a swing at Farian’s face. Surprisingly to both, it connected but not hard.

“Oof, ha ha. Even when addled the lovely Cara still has some fight in her!” He laughed as he dodged the second swing.

“Stop it this instant!” Cara yelled, “The Rains will be here soon and we still have picking to do.”

“To hells with the picking. I think the gods will survive if they miss one feast.”
“The gods will but I may not. You know how they can be when their hungry.”

Cara resumed her picking, mindful of how quickly the storm was approaching. Farian was watching her.

“Either leave or help me. You know I don’t like it when you stare at me.”

“You say that as if I could help it.” Farian smiled, “Anyone who wouldn’t stare at such a beauty must be missing a pair of eyes.”

Cara blushed, but she would be damned if she let Farian see, “Does every woman fall for that tongue of yours?”

“Some,” he said.

Cara kept picking the red fruit and Farian kept watching. From a distance over the sound of thunder came the low bellow of a horn; a great, yawning sound. “I suppose that’s all we can do for this harvest,” Cara said. She cupped her hands and yelled to the other fieldhands, “That’s enough, get back to shelter! We’ve done all we could.” The hands that had remained gathered their baskets and began to walk back. Cara stooped to pick two last ambrosia and place them in her basket.

“You’ve never stayed out in the Rains, have you?” Farian asked suddenly.

“Of course I haven’t. Everyone knows how dangerous that is,” Cara answered without even looking at him.

“What if I told you it wasn’t dangerous?”

“I suppose you want me to believe YOU have braved the Rains?”

“And what if I did? Would you think me brave?”

“I’d think you stupid. More stupid than I first thought.”

“I’m glad to hear you think of me.” He grabbed her again, only this time he hoisted her into his arms and began running. Running towards the bellowing clouds that were now almost overhead.

“What are you doing, Farian?” Cara asked, beating his chest, “You’ll get us both killed!”

“We won’t die, love. I promise you.”

“Alright, believe you,” Cara said hastily, “I believe you’ve been in the Rains, just put me down!”

“Not until you see it. Not until you’ve seen what I’ve seen.”

The clouds were above them now. The bright blue sky was cut by a great cloud of black before them, with lightining forking and spraying overhead. Great claps of light and booming sound filled Cara’s senses and she felt liek screaming. She could do nothing in Farian’s grasp but hide her face in his tunic. That’s when she felt it. The water burst from the sky in great sheets and burned her skin as it came into contact. Farian was running faster as he heard her cries. Suddenly, he slid and came to a stop and Cara no longer felt the sting of the burning Rain but she could hear its sound clearly. She lifted her face from Farian’s chest to see that they were under a small cloak stretched out from a stone that was hidden in the field. There was just enough room for them both huddled close beneath its protection.

“Are you alright?” Farian asked, “I thought I could make it before the Rains began.”

“I hurt a little, but unharmed,” she said, pulling small patches of hair that burned from her head. “What is wrong with you? How will we survive the Rains here? If the fields flood there will be nothing left of us but bones and ash.”

“The fields will not flood,” Farian answered with an alarming conviction, “I wanted you to see the reason of the Rains.”

Cara looked at him with questioning eyes, but he said no more. They both stared out into the mist of red water that poured from the sky, burning the meadows of ambrosia as white steam and smoke rose into the blackened sky. Back at the shelters, Cara knew that the hands were now preapring the evening feast, boiling the ambrosia down to a syrup and basting all food with its divine taste. Meats would be more flavorful, fruits would burst with succulent juices, vegetables would lose all staleness and perfectly compliment each dish. Ambrosia had no taste of its own, but only perfected the taste of every dish it was prepared with. Cara’s mouth began to water and in that instant she hated Farian for stealing her away from the season’s feast.

“There’s nothing to see here, Farian,” Cara said with a note of anger, “We get to eat with the gods once a season, and you took me from it.”

“And did you ever wonder why they gods only eat with us once a season; only when the Rains come?” Farian asked, “Its because they want no one to see this.”

As if beckoned by the sound of his voice, the Rains stopped and the thundering ceased. The dark clouds moved on past their small canvas, but the blue sky did not follow them. Instead, it was as if the fields were lost in a great expanse of glittering diamonds, millions upon millions or shining lights glittered and black expanse above. Cara stared up in wonder. The suns were no where to be found only the magnificent shine of the million lights.

“What… what is this?” Cara asked

“I believe its called ‘Night.’ I’ve read stories of a time when the suns do not shine and the world is cloaked in darkness with the watchful eyes of something called ‘stars.’ I believe those lights are what they are.”

“They’re beautiful.” Cara could not keep from staring. Her eyes were taking it all in, the brilliant lights in the sky. Sometimes it would look like one fell leaving a bright trail stretching from one end of the world to the other. The falling lights would cross and form patterns, like some unseen hand were writing on the heavens. Cara gasped and sat.

“It reminds me of you,” Farian spoke softly, “I said so when I first found this place. I could do nothing but stare at the sky, marveling at how beautiful it was.”

Cara turned to him and saw that he was looking at her. Gently he took her face in his hands and kissed her. Warmth flooded Cara’s face and lips but she stayed. If she did not love Farian she loved this moment, and she was grateful to him for showing it. She kissed him back.

They embraced and looked at the sky together. Cara’s mind was crowded with questions and she could not ask them fast enough, “How long does this ‘Night’ last? Does it come after every Rain? Why does it only come once a season? And why would the gods not want us to see this?”

Farian sighed at the last question, “I’m not sure, but I believe its because the Night is more beautiful than they are.”

Cara became silent at this thought. The gods beauty was all she knew until this moment. It felt as those this Night made life different, like it somehow changed her just because it existed. When the suns came back, she would be the same Cara but a different one too. She knew that there was a whole other world that the gods prevented her from seeing. Was there something even beyond the fields, in the lands where the Rains came from?

Cara yawned. She didn’t know how tired she became from a day of picking and she lay her head on Farian’s shoulder. In her last few moments awake Care stared at the night sky and wondered.

Ancestors, Pt. 2

2011-05-18T21:57:00.002-04:00

Over the course of the following month I had all but forgotten about the beautiful woman in red. I was convinced the encounter was due to some early onset of the flu or another mental malady. Perhaps my lunch had been disagreeable with my stomach, and my mind had decided to take part in the argument. In any case, I had returned to the cafe several times since the ghostly encounter had had not seen her again. Either she was simply a mad woman running loose, or my imagination had gotten the better of my faculties which was prone to happen from time to time, as my mother had always suspected.

The month of June presented itself with its own mind-jarring troubles, I’m afraid, specters notwithstanding. I had lost yet another job with the paper and I was immanently in danger of losing my present living arrangement with a rather young and seedy theater entrepreneur, especially since it was now both residents who failed to “bring home the bacon” as it were.

“You should move back in with your mother,” he said in passing one day, “That’s what I plan on doing.”

“Don’t be absurd, man!” I said, “I would never become such a burden. You may get away with such a scheme, but I am almost twice your age! Such a thing would never float well with my ego, and my mother would never let me live it down.”

“Your brother, then.”

“He’s a sorrier lout than you!”

“But he has got a job, hasn’t he?”

I paused, “Well, yes, he’s becoming quite the businessman dealing in soaps, but to room with a sibling at my years is almost as terrible as rooming with one’s mother.”

“Pity,” he said, “Dear ol’ mum must be proud to have such a dignified and respectable son.” He laughed and lit a thin cigarette, nestled beside our fourth story window. I could not abide the smell of smoke, he knew well, and so I took that as my cue to exit. I had been meaning to pay mother a visit, in any case.

The walk across town to her flat was a long and dreary one. It had been raining for several days and I had failed to remember to grab my umbrella in my haste to avoid suffocation. It was not a downpour on the streets of Chicago, but it was heavy enough to seep through the seams of my overcoat and make my suit thoroughly damp. By the hour I reached her doorstep, the only dry part of my person was the thinning hair beneath my hat.

“Get in, you fool!” she said upon seeing my misery, “Who leaves their home in this weather without an umbrella! I raised you better than this. You’ll catch cold and give it to your frail, old mother!”

“I certainly apologize should it ever come to that, mother,” I said.

“I suppose I should worry,” she said, “You haven’t given me anything in years! Why should I be concerned that you would start now?”

“That isn’t fair, mother,” I responded, “You know money has been a hard to come by these last few years. Besides, I gave you that book last year on your birthday, remember?”

She prepared two saucers of tea as I sat at the modest kitchen table, “Oh, what woman my age wants to read these days,” she exclaimed, “I’ve got to keep up appearances to the other widows at the Society! Your dear brother got me these.” She tilted her head to show a pair of pearl earring dangling from her ancient earlobe.

“You’d best be careful, mother,” I said, “With pearls such as those it may be difficult to hold your head so high. Why, they might prevent you from looking down your crooked nose to anyone else!”

She gave a cackle that sounded more like a cough, “Say, what you will about me, but the Society maintains certain standards. It take more than just losing a husband to hob-knob with those kind these days. And without them, your dear old mother wouldn’t have a thing to do but spend more time with her dear, loving children.” She pinched my cheek and gave it a little slap at the end.

“By God, I shall seek a bank loan immediately! Fine furs! New slippers! The greatest necklace money can buy! Anything to keep mum happy and away!”

We laughed so hard that the tea waved and spilt onto the table. Mother wiped away a joyous tear, then said, “Oh, it would be a joke like that that would have kept your father roaring for days, God bless his soul,” she patted my hand, “It was sweet of you to visit on the anniversary, dear.”

“Has Terry been by?” I asked.

“Not yet, but he’s been busy with soap these days,” she said, “At least one person in this family can still hold a vocation.”

“Mother, don’t be cruel,” I said, “You know that I’m trying.”

“I know that, dear, but I’m worried is all,” she said, “you got to learn to stop chasing these dreams of yours and settle down. Find a nice wife to take care of you. Have children. Get a proper job and stop with this writing nonsense. Its what yoiur father wanted, and God knows I would feel so much better.”

“Please, mother, not this conversation again,” I breathed in deep and prepared myself, “I cannot be something I am not, and I cannot be Terry?”

“But Emith, dear, Terry is your younger and he already has two lovely children! You’re slowly reaching middle age and have so little to show for your life. One book is all, and it s a wonderful book, Emith,” she said quickly seeing the hurt in my eyes, “But it cannot feed you, or keep you warm, or love you like a family can.”

“I’m beginning to see that clearly,” I said

“Oh, come now, don’t be sore. I only want what’s best for you.”

“You only want more grandchildren and pearls!” I said playfully.

“There are few people in the world who can appreciate the value of such things,” mother said, putting her hand to her ear, “But enough of such talk. How would you like to play a game of chess? I tried to teach the women of the society but they showed absolutely know interest.”

We had played several games that consisted of forks, blocks, and draws. We had always taken each loss against one another deeply personal, so most games were taken to our wit’s end and finalized with nothing but a pair of kings and pawns. Always anti-climactic.

Upon leaving mother’s flat, she gave a final word of judgmental advice (she simply couldn’t help herself) and sent me home. The dampness had cooled in the setting sun, making the air heavy with an evening fog. As I walked, I encounter a most curious sight. On the side of the road, underneath the orange glow of a streetlamp, stood the contradictory figure of an Indian man, red-skinned with braided hair, and wearing naught but a pair of animal skin pants and long feathers beside his face.

When I saw him I stopped. My eyes took him in for a few moments, and decided that the appropriate course was action to take was to blink. I did, several times, but there the image remained. In the bloody middle of the Chicago city was an Indian savage, far from any tribe, plains, or hunted animal. He stood squarely between me and the entrance to my recently unaffordable home and so I had little choice but to pass his figure. I chose to walk quickly past and avoid any sort of contact; eye, courteous, or otherwise with the hopes of being pleasantly ignored.

Perhaps I moved too briskly. Mayhaps I expelled a cough that brought attention to myself. It could be the case that I stared at him a little too long. Whatever my mistake, he turned to me as I walk towards him, and he stared at me with the deepest and most lively eyes I had ever seen. I could not help myself but stop my brisk beeline to my apartment door. We gazed at each other, and neither of us said a word.

After a brief moment (it could have been a second, it could have been a year) I started to slowly pass him. Still silent, his hard, stone-like face followed me as I went. I dared not match that sort of visage, and so I glided past without another look. Coming to the door to my apartment my keys jingled as I removed them from my damp pockets. I dropped them as I tried to open the door and used the opportunity to take one last look back. He was gone. Only a single lamppost met my eyes. Again, my eyes determined the appropriate response would be to blink, and so I did, looking both left and right for the mysterious Indian, but he was no where to be seen.

That night I slept soundly, better sleep than I had received in weeks. I awoke with the rare existential sense that all was right with the world, and that today was a day of destiny. I lept from bed, arranged my clothes for the day, and decided to find a new outlet for my writing. I would use my recent misfortune in unemployment to begin a new book, one that would sell, and one that would love me as a family would, despite my mother’s beliefs to the contrary. It wasn’t until it was noon time and I was a quarter of the way through the twelfth page that I realized I was writing about the woman in red.

Ordination, Pt. 1

2011-05-16T22:04:00.002-04:00

The sunlight glided slowly through the stained glass windows illuminating the oak pews with greens, blues, and reds. Small specks of dust floated through the air with no direction. The hard stone walls and marbled floors gave no quarter for the movement of air and did nothing to dull Michael’s footsteps as he approached the sanctuary. Bishop Balthesar heard him approach.

“Ah, Michael,” said the plump Bishop, his booming voice echoing through the silence, “My favorite catechumen! Thought you’d have one last confession as a mortal, eh?”

“Not exactly, father” Michael said with a grin, “I just came to see the place off.”

“Fitting," the Bishop said, "These halls won’t be the same without you. Its a shame really, you would have made such a wonderful priest.”

“I’d like to think so, but God has other plans for me.”

“So it would seem. I will leave you alone then. But this isn’t goodbye, not yet! I want to share one more dinner before you grow those wings!” the Bishop laughed as he walked the length of the sept. Once he was alone, Michael took a deep breath. The smell of the sanctuary was always old, like the fragrance of wisdom. He approached the altar and knelt on the red velvet steps that climbed to the stricken symbol of the man Jesus; a body racked with wounds and a crown of bloody thorns. Michael couldn’t help but laugh at the face of the ancient statue. The sculptor had the eyes all wrong. Jesus had more fire behind them, he knew; less pain and anguish.

Michael bowed his head and closed his eyes, beginning his afternoon hour of prayer and he had much to prayer. This was his final day as a regular man. Tomorrow he would change and take the burden of servitude, the 'iron wings' as they were called and enter into the Kingdom of Heaven. He prayed words of gratitude to be selected for such a priviledge, and he prayed for the strength and wisdom to serve his God and his Church with power, honor, and justice.

As he uttered the words of the Our Father, the walls of the church began to shake. A great shadow passed overhead and the light slowly emptied from the sanctuary as the roar of a Vatican convoy landed outside. Michael took one last breath and finished his prayer with an utterance of complete devotion and love for the Divine.
The massive doors at the nave swung open, and immediately the charge of two dozen Vatican Elite stomped between the pews and columns. A Herald entered and blew a resounding trumpet blast. “All hail Her Excellency and Holiness, Popess Ester the Seventeenth!” The Herald blew the trumpet another three times, each one longer than the last. The young Popess then entered in bright gold and scarlet robes flowing around her, a pearl staff topped with an azure emerald in hand, and a sparkling diamond tiara worn only by those touched by the Spirit of the Divine. She approached Michael slowly but when she met him face to face, it was the Popess who knelt to him.

“Great Michael, the one whom God loves. It is an honor to meet you.”

Michael stumbled as he spoke, “Please, rise, your Holiness. It is I who should be bowing to you. I have not yet earned my wings and do not deserve such honor.”

“Humble to the last,” the Popess said smiling, “We would do well to follow your example. But your sacrifice deserves no such modesty, and I would see one of our Truly Faithful in human form before his Conversion.”

“It is a great and unexpected honor, your Holiness.” Michael knelt and kissed her extended hand.

“Herald,” she said, “I would have a word with this one in private. You and my guards may be excused.”

“As you wish, your Holiness.” The Herald waved a signal to the Elite and they quickly exited the nave. The Popess watched them as they left and said nothing until the great oaks doors slammed shut. It was then when she turned and immediately bounded at Michael. He caught her quickly and she kissed him passionately.

When their embrace was done she lowered herself to the ground but never took her eyes away from his. “Oh, Michael, I thought I would never see you again!”

“Nor I you,” Michael said smiling, “That day you became Popess I was certain you would forget all about me. Who would have ever imagined that my little Jess would become the Holiest person in all the Church?”
The Popess blushed, “You of all people know there are plenty more Converts a good deal holier than I. And I’m not Jess anymore. I’m Ester the Seventeenth.”

“My apologies, your Holiness.” Michael said, “But you’ll always be little Jess in my eyes.”

“I’m glad someone still remembers.” She smiled and kissed him again. “Come, sit with me. We have a lot to talk about before you get those wings of yours.”

“So I imagine,” Michael said as he sat beside Jess in a front pew, “Is it you I have to thank for this honor?”

“Not mine any more than yours,” she said. Noticing his disbelief on his face, she responded seriously, “Michael, I swear to you I had nothing to do with it. This is the last fate I wished for you, but God works strangely and is very selective in what he says to us. He keeps secrets from even Jesus these days, and its put enough strain in their relationship. The Son is off fighting the war, and the Father broods. Its getting to be more than I care bear.”

“Things are really that bad at the Vatican?” Michael asked.

“My beloved, you don’t know the worst of it. We’re losing the war. We encounter more and more Fallen Converts everyday, and the relic we found on the last expedition turned out to be false and we couldn’t hide it. Riots outside the Vatican are getting worse and the Spirit is getting far too wild. The Trinity could help if they would only show their faces once in a while but even with all my pleading they don’t utter a single word. Damn it all, Michael, its been more than three years since there’s even been a bloody miracle! The words ‘False Gods’ are on everyone’s lips and that blasted Trinity doesn’t even care enough to hear.”

“Blasphemy isn’t very becoming of you, my love,” Michael said, “How did you ever get to be Popess with a mouth like that?”

“You know damn well I never wanted this,” Jess said.

“I know, I know…” Michael said, “Just like I don’t have much of a heart to have a ton of iron burned into my back.”

The Popess took Michael’s hand sweetly. He held it tight and sighed, “So the people need a hero, eh? A new Savior, is that it?”

“Something like that,” Jess said, “The Church hasn’t seen in Archangel in over a century, not since Gabriel fell. It would do us some good to raise us some heroes instead of losing them.”

“Alright, then.” Michael said. Jess laid her head in Michael’s lap and he stroked her hair softly. The silence of the sanctuary was all the witnessed the care between them, a Popess and almost-priest. After a time, she raised and looked into his eyes. “Just promise me you won’t turn out like the last Michael,” she said.

“My love, as long as I have you with me, that will never happen.” He kissed her and stood. “Come now,” he said, “You have a church to lead and I have a Bishop to entertain.”

“I wish you could stay with me tonight,” she whispered.

“So do I. But fear not,” Michael said, “I will always love you.”

“Fear not?” Jess laughed, “You’re sounding like an angel already!”

They laughed as the Popess walked the aisle away from the sanctuary. She turned to have one last look at Michael and called for the Herald to return. She was escorted out of the church surrounding by Vatican Elites with their massive gunblades. The silence returned to the sanctuary as the convoy lifted off, and the sunlight returned to warm the air. Michael stepped to the front altar that decorated the sanctuary and lifted the golden lid. Inside, a sword made of Divine Steel lay, crafted by the First Archangel in the Fire of the Spirit and Tempered in the Son’s First Blood. It was Armageddon, the sword that sealed the Garden, the blade that could end the world. Tomorrow, Michael would wield the sword as the Seventh Archangel, and signal the beginning of the end to the war between Heaven and Earth.

Ancestors, Pt. 1

2011-05-09T19:08:00.002-04:00

What had begun as a common day in a common place had quickly turned into something very uncommon. It was a lovely spring afternoon with bluejays chirpng in the spruce trees that lines the walk to my favorite restaurant, a quaint little place where the woman in the kitchen was a loud and bombastic Swedish redhead. I was enjoying my usual lunch of soup and cobb salad with too much vineagar when I saw a woman who I wasn’t supposed to see. I could tell I wasn’t supposed to see her because no one else did. She was the sort of woman you could not help but stare at; beautiful, attractive… the sheer gravity of her face when she smiled was unmistakeable. It would be impossible for any breathing individual to fail in taking notice. But there she was in that busy place, and my eyes were the only ones who saw her. And she took notice.

“Excuse me,” she said as she caught me gawking at her, “I couldn’t help but notice that you’re staring at me.” She said this with a playful tone , as if she had caught a thief and instead of screaming his crime to the world, she decided to join him in the act.

“I’m sorry, my lady” I began, slightly more flustered that I was caught gawking than the act gawking itself, “ I couldn’t help but wonder why such a beautiful woman was not getting more attention.”

She smiled shyly and looked down to the ground. She wore a beautiful red dress and a large woven straw hat that rippled slightly in that early afternoon breeze. Small droplets of sunlight peeked through the weave and dabbled her face. It was as if the sun itself was trying to steal kisses from her inviting cheek. She raised her face and her eyes met mine for the first time. I was struck by how old they seemed; how much life they seemed to contain, but I disregarded it as a trick of the play between shade and light. I offered her the seat opposite mine, and to my joy she accepted.

I gave her tea and she drank it happily. It was Earl Grey, slightly dark in taste but pleasing in aroma and warm to the soul. I offered her a chance at food, but she declined. She made the curious comment that she had not the stomach for lunch in years. I began to believe that if it was her looks that had such a strong attraction, it was her personality that made men the fall in love. She had a spirit of kindness, compassion, and sheer brilliance that would strike fear into most men’s hearts but she was also humble, perhaps even a bit shy. I believed that to be her most endearing quality. In our brief introductory conversation, I could only say as much to her directly.

“Well, I’m glad to hear you say that.” She responded, “I was worried that when I finally got around to meeting you, you would not like me.”

“Why, whatever do you mean?” I asked, “We have only just met and I most certainly sure that I have never seen you before. I would remember such a lovely face is yours.”

She laughed a warm and knowing laugh. “You may not have seen me, but I have seen you. I have been following you for some time. To be sure, I was sent to meet you here, in this place, at this time. I was more or less waiting for you to notice me. Or perhaps a better way to say it is… when you were ready to notice me.” She placed a pause between the words of this last phrase as if she gave it a second thought, but decided it was safe to mention. Unfortunately, it was so enigmatic that I had no way to make heads or tails of it. She continued with her riddle, “I think I can tell you that I know what you have been going through, and its alright.”

I was startled to hear her change in tone. She was still playfully charming with her smile and sun-spotted face but her words were spoken with the deepest kind of truth, the sort of truth you do not yet know, the sort that can shake a man with fear. I attempted to respond to her playfully, though cautiously, “My dear woman, I’m afraid I don’t quite understand your meaning. I am flattered to think that such a woman of your caliber could perhaps be so smitten with me from a distance that she only now summoned the courage to approach me, but I wonder if there is something befuddling and hidden in your words, and I’m afraid I’m much too daft for riddles. Perhaps you give me too much credit for intelligence.”

She began such a fit of laughter and touched her hand to her breast. She had such a joyful laugh, so full of life and frivolity, one that a woman her age rarely has. It was a laugh that could only be possible with age. It was one that seemed untouched by grief, unbeknownst to any form of heartbreak or sorrow. It was a laugh that a man could hear for his whole life and never grow tired of it.

“Daft you may be, my old and new friend. And though I do speak somewhat in jest and riddle, I do not mean to withhold anything from you. You were very receptive when you said no one had noticed me, for that is a very true statement. That is because I am dead.”

She uttered this last sentence with the same smile she wore from the beginning. But it was not a warm joyful smile nor was it a cold angry smile. It was a simple, knowing, truthful smile full of assurance and confidence. It was a smile that meant what she had just spoken was no lie. Suffice to say, I was quite startled and for a moment my mind was befuddled in trying to conceive the idea that this beautiful woman whom I had just met spoke of being dead. Who was she? Was she ill of mind? Perchance sick on some opiate, or like those who only have the mind of a child, making everything a game or trick? Or, despite all objections of reason, was she truly among those of the great cloud of witnesses, as the holy men so described?

Seeing as my curiosity was at the very least peaked, I began with an investigative question, “Dead? Forgive me, my lady, if such a statement catches me off guard. If I be silent may it be your interpretation that a reality in which such a beautiful woman as yourself is to be dead, then I am muted by the injustice of this world.”

“You are too kind, Emith. And a flatterer. You remind me or my husband.” Again, spoken with that knowing and confident smile.

What was once confusion in my head became terror are in my heart. I have not spoken my name, nor she hers. Yet she knew what it was. She apparently had some for knowledge of who I am, and so she was at an advantage. I did not fear for my life in those moments, but I cannot say what my fear was. All I knew was that a beautiful woman who claimed to be dead sat in the form he, and she knew my name. And what was more, this angelic vision was married!

“How…”

She interrupted me by placing her soft hand upon my own. “I know everything there is to know about you, Emith. And I’m here to tell you there is nothing wrong with you. You are charming, lovable, and brilliant just the way you are.”

I was not prepared for this. Something at the very core of my being told me to run away and so I grumbled some brief thanks, removed my hand from hers, left some paper bills on the table, and quickly made my exit. As I walked amongst the spruce trees and bluejays my mind was preoccupied with the encounter. Who was this woman? How is it that she knew who I was? What did she want with me? Why did I feel so afraid? And why, damn it all, why did I feel like crying for the first time in years?

Tears welled in my eyes and I stopped my pacing. I fought back the sadness of the loneliness of years and instead resorted to forgetting anything had ever happened. It was simply impossible that such a beautiful woman could exist, let alone claim to know me as well as she had. I returned to my flat exhuasted and worn, and so I retired praying that I was not losing my mind.

Vocation

2011-04-13T21:13:00.003-04:00

Jakob looked about the room nervously. A young woman steated next to him stared at the opposite wall, obviously looking at nothing intently. A young man sat across from him and twiddled his thumbs, breathing nosily through his mouth. The walls were white and the room was hot.

The door opens. In walks a Red woman with pursed lips. “We seem to be missing one.” She notes with visible annoyance as she scans the room. She has a look the makes Jakob shutter. “No matter. We will begin on schedule.” She decides.
The Red woman wore a deep red sweater with a red skirt that flowed and pooled around her. She took her place at the podium in the stuffy room and looked out to the three candidates. She smiled, but it was the sort of smile that held no happiness, only courtesy. Jakob knew that behind those lines of white teeth seethed an anger and a power that no one could withstand. He sank a little lower in his chair.

“Welcome, candidates!” The Red woman began, “You are here because you have been selected by your peers for vocational and personality training. Congratulations!”

The three candidates showed no semblance of interest. Jakob avoided eye contact at all costs. The young woman smiled blankly and the young man continued to twiddle his thumbs.

“Please pay attention to this brief orientation video. It will explain the process of the next few days as well as what you might be able to expect from your time in-capsule.” With that, the Red woman cut the lights and began the video. The bright white of the initial screen stung Jakob’s eyes so much that they watered, but he dare not blink. He did not want to miss a moment of the video. His life may depend on his attentiveness. From the corner of his eye, he could see the young man yawn and start to nod off. The young woman appeared to be looking at the wrong screen.

The video cracked to life and a handsome man in an expensive suit greeted the viewers, “Welcome candidates to your vocational and personality training course!” Even in the gray-toned video the man had noticeably white death. He smiled often when speaking, but there was again no happiness. “My name is Slake and I will be guiding you through the initial steps of this exciting process. I know you must have dozens of questions, and I hope to answer many of them in the next few moments. For now, I want to introduce you to a friend of mine.”

At that moment a cartoonish puff of smoke appeared beside the character Slake. It quickly dissapated to reveal a life-like cartoon capsule but with sticks for arms and legs, and two large, round eyes. “Well, howdy, Slake!” the capsule spoke, “fancy seeing you in these parts! And you brought some friends!”

“That’s right, Cappy.” Replied Slake, “These are our new candidates!”

“Well, hot dog, ain’t that excitin’!” the capsule exclaimed while slapping his twigish thigh, “Pleased to meet you folks! My name’s Cappy, and I’m a vocation capsule! Do any of you know what that is?”

Slake laughed, “Well, of course they do, Cappy! You’re the reason we’re all here.”

“I know that!” Cappy replied jovially, “But does anyone know what a vocation capsule actually does?”

“Come to think of it, Cappy, I don’t think even I know exactly what a vocation capsule does. How about you tell us?”

“I was fixin’ to do just that…” The screen became wavy and staticy as the background music began to fluctuate and skip uncomfortably. The picture went a stark, blinding white again, and Jakob’s eyes watered.

“This awful machine always malfunctions, I’m afraid.” The Red woman began, beating her hand against the projector. “No matter. I’m sure you all know enough about the capsule to forgo any orientation.”

Jakob knew nothing about the capsule, except that it could kill you if you didn’t know what you were doing once inside. But Jakob was too afraid to ask any questions. The Red woman would as soon tear his mind to pieces than tolerate any of his low-born ignorance. He began to perspire, sweating beading and streaking down his forehead. The young man kept staring at his thumbs, and the young woman kept staring at the pale white wall

“You, there” the Red woman interrupted Jakob’s anxious observations, “For what reasons have you come today?”

Jakob’s mind was a blank. He opened his mouth from fear of not saying anything and appearing stupid, but it was that same fear that prevented any words from coming out. He coughed in a vain attempted to hide his social dullardry. Both the young man and young woman were now looking straight at him with disinterested attention. What was worse, the Red woman had begun poking around in Jakob’s mind and had no doubt discovered his fear and anxiety by now.

“Oh, you dear boy,” the Red woman began, as if to drive her discovery home, “You have no reason to be afraid. You have the most to gain from our services. You’re a much better candidate than these two foolish creatures.” She referenced the other two with a wave of her hand and immediately, the two shuddered with brief convulsions and fell limp in their chairs. The were the victims of a quick personality wiping. This was the power of the Red woman; the reason Jakob feared her so. With only a thought she can change you, make you forget who you are. She can create and destroy the very essence of a person.

“Or, to be more correct, it is because of your fear that you are the perfect candidate. It makes the catching of new personalities and vocations far easier.” She sat on the edge of the table and crossed her legs, staring down at Jakob with hunger in her eyes. “Where are you from, young man?”

“Th.. The Calypso system, m’lady.” Jakob stammered, avoiding her gaze.

“I see. Low-born, hmm?” She tapped her fingers against her knee and the placed her hand on the top of his on the table. It looked as if she wanted to be comforting, but she almost crushed his hand with her strength. It was all Jakob could do to hold back tears and screams of pain. “Someone must have paid a great deal to see that you come here.”

“Yes, m’lady.” Jakob replied, wincing through his teeth, “My father requested it in his will after he died. He want to see that I got a proper job.”

“Oh, you poor thing.” Still crushing Jakob’s hand the Red woman gently caressed his face with the other. “Not only are you far from home, but you have no family waiting for you when you return. I understand he was your sole caretaker?”

“Yes, m’lady.”

“Well, you will be taken care of here. I have a special program set aside for someone just like you.” The Red woman released Jakob’s hand and stood. His fingers were flushed with blood and red like the woman’s eyes but Jakob dare not move them. Any sign of weakness could mean instant wiping. He tried to think as little as possible. The Red woman was in his mind, but if he concentrated on the pain, on the sweat, on the feeling of the blood in his veins he could keep his mental transgressions down to a minimum.

“Before your appointment, we must test you.” The Red woman moved to a cabinet on the other side of the room. She clumsily shifted the chair of the limp young man to access the cabinet, but she must have moved him too hurriedly. He fell out of the chair and smashed his nose right into the table and stayed there, face down onto the surface of the wood. He made no move but slowly began to slide off the table, a small smear of blood following his descent. He collapsed into a slump underneath the table and Jakob shivered at the sound of limp arms and legs sloughing to the floor.

“Oh, dear. How unpleasant!” The Red woman exclaimed with disgust in her voice but a slight smile in her mouth. She retrieved a large bundle of papers and two writing carbons from the cabinet. As she turned and approached Jakob his eyes met hers for an instant. They were pure fire, blazened with wisdom and power and malice. A ribbon of terror slipped through his mind to the core of his stomach. It made him shiver slightly and the effect was not lost on the Red woman. “There, there, now…” she said softly with a coy smile. “I’m not going to erase you. You’re far to innocent and pleasant.” She lifted her hand to caress Jakob’s cheek. It may have been somewhat sweet if her touch were not so cold. His flesh burned with sweat at the touch of her skin but he could not pull away. She lifted his head to look into his eyes again. They met, and he was powerless. She used her force to tunnel her way into his mind and there she stayed; burned red and deep into his memory so that her shape and her will could never be forgotten. It was over in an instant, and Jakob gasped as if he took his last breath. It was done. He was now hers. The Red woman had gained possession of Jakob’s very soul.

“Very good.” The Red woman spoke with a sultry voice, satisfied in her conquest, “You have a bright future ahead of you. We will give you a new name and a new vocation. You may even become great. It is for the capsule to decide.”

She placed the papers and writing utensils in front of Jakob on the table. “Take these tests while your vessel is prepared. I shall return for them momentarily.” Jakob obeyed, forgetting that he didn’t know how to read or write. But at that moment it didn’t seem to matter. His hand traveled across paper and his eyes across words as if they could read and write for him. His body acted independent of his mind. Jakob was now a prisoner in his own flesh. The process of personality replacement had already begun.
__________

Jakob did not remember finishing the tests. He vaguely recalled the bodies of the young man and young woman being wheeled out of the room, she still with the blank face, and he still holding his thumbs. He did not remember the Red woman returning for the tests but he also did not remember her leaving. It felt as though she was always there, even though Jakob knew that she wasn’t. The Red woman took his hand and led him away from the hot room, down a humming hallway full of doors. Sleepily, as if in a dream, he came to his capsule. They stood by the vessel when the Red woman took Jakob’s face and kissed him deeply. Jakob tried to scream in protest but no sounds came. His body moved in unison to hers and a great heat flooded his mouth. Jakob felt a mix of pain and pleasure and dread as she lingered at his lips, but he could not pull away. Slowly, her hand lowered to the capsule and opened the lid. A loud hiss erupted as the cleaing gas emptied and swept around them covering everything in a white haze. The Red woman never broke her gaze from Jakob’s, and as she kissed him once more she lowered his body into the capsule.

“But… I don’t want to go in. I don’t want to sleep…” Jakob’s voice was getting slower and more slurred. His arms were heavy and acting of their own accord. Nothing Jakob willed could change his fate now.

“Don’t worry.” The Red woman said gently, “When you wake, this will all be over and your vocation will have been selected for you. You can look forward to a peaceful rest and awaken to a productive, meaningful life.” She closed the lid and the white haze gathered around Jakob. The Red woman stepped away from view, disappearing into the mist of the assessment gas as music began to fill the capsule. Pleasant harmonies of hundreds of string instruments begin to lull Jakob to sleep. The last thought Jakob had was that of his father, and if he knew what hell he condemned Jakob to.

What would he awake to be? Would he awake at all? Jakob’s memories began to shift and fade, merging with each other and losing form. Order was becoming out of place. Past birthdays and holidays were mixing with trauma and weathers. Faces were beginning to change in his mind’s eye. Did he last see his mother, or his pet canine? Was his favorite food eggs or plastic? For some reason, he remembered them now looking and tasting the same. The only thing that remained, in the midst of the growing swirl of blackness and blur of remembering, was the Red woman and her eyes of fire. Jakob was certain that whatever became of him, his personality, and his vocation, she would remain.

Unemployment

2011-03-28T16:21:00.002-04:00

Damn. What an awful day. What an absolutely, positively, undoubtedly and decidedly terrible day. Damn.

"Fine. Thanks for letting me know. Yes, I know. Grass is always greener and all that."

I hung up the quant-comm with a firm press of my thumb to my ear. Damn new tech. Hanging up just doesn't have the emotional punch that it used to. Especially when angry. No more throwing a cell phone across the room, or smashing a receiver to bits on the counter. Just a regular thumb press to the ear flap of the quantum communicating device and the conversation is over. You look exactly the same ending a conversation with your best friend as you would with an ex-wife. Just a damn thumb to the ear, though I suppose we could still smash our damn heads against a brick wall. I bet that'd have the same effect. Might even feel better, too, depending on the conversation.

I should have seen this coming. I know that a person never gets something for free on this god-forsaken planet any more than you'd have some bugger give you his shirt off his back. Promotion, my fat ass. They were just greasing me up to shove me out the door. No one in their right mind would turn down a promotion, would they? Certainly no one would ever expect getting "let go" just a week later.

I don't understand. What did I do wrong? What did I do to deserve this?

What am I worth now?
_____________

I dreamt that night. It was the most realistic dream I've ever had. It was... malleable. Everything felt at one with me and I was at one with the universe. Everything was an extension of me. I could feel the tree, the ground, the air as if they were all a part of me. I could feel them living. I could see the ground at my feet without looking. I could feel the wind in each head of wheat when I breathed. In the distance, I heard a knock and I saw a door. I knew I was the one that was supposed to answer. I knew who was behind it before I opened it. I cracked the door the door and everything faded to black. But I knew that it would.

A voice came, sounding familiar, "Max, could you come to my office?"

I see me without being there. Someone is playing a hologram of my life, only I feel everything as it happens. I see all angles. "Uh oh. Looks like I'm in trouble, Ted!" I tell my co-worker. We laugh. I walk the long hall to my supervisor's office, her great holographic name and title shimmering above the doorway. I walk with energy, with life into the room. The blues look bluer outside, the faces of people a bit happier. I arrive.

"Close the door, Max."

I look at the two women, my boss and her secretary. I smile but I'm anxious. The air in the room changes to something heavier, something laborious. I shake me head to clear my mind but I fail. My mind begins to race. Who died? Who got let go? Damn, that would be the third time this month! This company is going down the tubes... Somewhere, I hear a bird chirp and sing. Wasn't it a long winter just a week ago? Where did the spring come from, and where is it going?

"Go ahead and take a seat." she says. I sit. I cross my legs. The secretary says nothing. I see her say nothing, and she nods.

My supervisor speaks. I think of her words before she says them. She's just an extension of me.

"As you know, it's been a hard month here. I was hoping things would get better, and I still believe they will but..." she breathes. I breathe. The secretary doesn't. She just nods. "We no longer have the resources to support your position."

The blues turn red. The bird stops chirping as if I commanded it. It turns back into winter. Spring disappears. "Ok." That was all I could get out. I was screaming in another life. The part of me watching all this happen. Screaming and ripping and fuming. I did everything right. I did everything right!

But I should have known, I say to myself. I should have known. How could I have known? But someone did, and that someone wasn't me.

"You'll get your two weeks pension, and you will be able to apply for..." something catches in her throat. It's her words. She can't say them but she doesn't have to. She an extension of me. "Unemployment. You'll be able to apply for that."

"Ok." I say again. I can't remember any other words. They're all caught in her throat.

"But we're a big company. I'd love to recommend you for any position you apply within."

"Really?" the words came rushing back, barrelling out cold and hot. The winter had entered into my body somehow but the anger was still there. Words mixed together like I said a thousand things at once, "Is our managerial company hiring a lot of managers?"

Tears began to well in her eyes. It wasn't harsh but I saw she was hurt. I knew she was hurt. The winter outside turned to fall and the leaves fell as she cried. I didn't want to be the strong one. I wanted to be the one with the paycheck. She was paid to be strong. I was getting fired. The secretary nods at nothing, then shakes her head at nothing. She got paid to nod and shake.

"Hey, everything's gonna be alright." I say, taking her hand in mine. "Don't worry. You'll get through this." As if I knew. I hoped they wouldn't be alright.

But she got through it. Things went fast forward. She fired five other people that day. And got paid $38.42 an hour doing it. While my dream oscilated between winter and fall, anger and pity, she was in summer. The secretary folded her arms and again nodded at nothing. I began to hate that nodding. I was so consumed that the dream ended. I woke to a dark room and a mockingbird singing outside. There was no light out. It was the beginning of spring.

___________

*CRACK*

"Goddammit!"

I fall to the floor in a heap, clutching my shin. I ran into the coffee table for the third time that week and struck the same spot each time. I had also applied for three different jobs. I'm not sure which hurt more.

It had been three weeks. I was bored. It was full on spring. The birds were still outside. I never applied for unemployment.

"I know what hurts more." I said to the birds, to the winter, to that damn secertary that nodded at nothing. "It hurts knowing that there was nothing I could do to prevent this."

I catch the blood from my shin, lick my fingers and wipe the wound as the welt surges to a greater size. There were three more applications to write and I didn't want to.

Loneliness

2011-01-19T11:40:00.003-05:00

AUTHOR'S NOTE: Hey, all. December was a terribly busy month, but now I find myself with oodles of time on my hands. Thanks for being patient.

_________________

Loneliness can be a heavy thing. Heavier than the entire world placed on your raw shoulders. It is a curious thing, how the absence of another can great such an overwhelming feeling of sadness and regret and you simply cannot fathom how you could live another day. The very act of surviving becomes a chore in isolation: breathing take more energy, the thought of cooking food is repulsive, even just getting out of bed in the morning is an insurmountable challenge. The heaviness of loneliness keeps you in bed, leaves the dishes in disarray, makes breathing painful.

But there are a select few to whom the powers of loneliness appear ineffectual. Joselyn was just one of these persons (we called her Josey for short.) I first met Josey at a very young age and even though she was two hundred twenty years my elder, I loved her.

She had never had any children of her own, though many of her relations would call themselves her children. She was quiet, proper, and never spoke out of turn. She reminded me of the woman that never made it into the history books, the sort of woman that would stay home and worry while her husband was off at war. The sort of woman that cooked family meals and clean clothes three days a week. The kind of woman that still believed in Spring Cleaning, back when there was such a thing as Spring.

However, in spite of her passivity Josey was strong. She would needed to have been to survive as long as she did. She was a widow; her husband of eighty years had died when she was at the ripe age of one hundred and seven. He was a beast of a man and knew the way of the world better than any I had known. He rose from humble beginning to command a small empire of his own and his wife had never had to want of anything, though she was blissfully ignorant of just how rich he was or how he got that way, even after his death.

I have come to believe that was the secret to Josey's happiness: blissful ignorance. And though in all aspects of her life she was compliant and submissive I think she devoted extreme energy to not knowing the world around her.

I remember, as a boy no older than thirty five Josey invited me to dine with her and her husband. She was preparing a recipe for a dinner party and I was to be the test-subject, as it were. I jumped at the opportunity as Josey was known to be a fine cook, but it wasn't until after I had arrived at her home that I realized this would be my first experience with both she and her husband together. I had met them both on separate occasions (my career-line had introduced me to Richard, her husband while my personal-line is where I met Josey).

Josey immediately embraced me upon opening the door and lead me by my hand to the dining table set with fine linen and priceless china. Richard was already seated with a napkin stuffed beneath his chin. He waved amicably for me to take a seat opposite him. The lighting was low and intimate and I became worried that this was a more formal occasion than I was prepared for. I sat with some anxiety until a divine smell wafted into my nose. The scents of chicken, spice, apple, and fine wine calmed by nervous mind and set my mouth moist with anticipation It soon became clear the level of work Josey had put into preparation: a five course dinner that was scrumptious to the senses. Richard and I sat and ate and I was so overcome by the delicious artistry that was set before me that I failed to noticed that Josey was not eating with us. Upon realizing this I exclaimed, "Richard, where is Josey? She should be enjoying this with us!"

"Josey is fine," he replied with a grin, "she will join us later."

Though this bothered me slightly my disappointment was soon relieved by the third course: a, expertly roasted whole chicken brimming with juice and flavor. The evening continued without incident, with Josey only appearing to provide more food or libation. After dinner, Richard and I retired into the sitting room to discuss the career-line and further business endeavors. Josey was not present until I began to make my departure. She appeared behind her husband and thanked me warmly for coming. I expressed my gratitude for the exquisite meal and returned to my single flat. That evening I dreamed of living with Josey and Richard, as two parents with a single child. It was a home filled with love, laughter, memory and free of longing. In the shorts hours of the evening I had lived holidays and vacations, family meals and arguments, growing up and moving out of the family which I had never known. I awoke with tears in my eyes and pain in my heart.

Less than a week later, Richard was dead. His blood health was not as good as it could have been and a sudden viral aneurism took his life in the night. There are not words that can express what Josey went through, and I am ashamed to say that I don't quite understand it myself. For several days she was silent, speaking to no one and seeking no help. But beyond those days she emerged as the same Josey everyone knew, quiet, submissive, and always willing to bestow a pleasant and caring smile.

It was almost as if Richard's death affected the whole world, but changed nothing in Josey. We had anticipated some grief, some suffering, some change in her but we found none. It was the waiting that changed us, our closeness to her that made us different. But to Josey in her blissful ignorance nothing was different. Certainly, the man she had married was gone but her happiness remained. Some have called it denial and some feel she may have succumbed to a mental malady, but I do not see it this way. For what I know, I experienced for one evening the family I had always wanted and Josey knew that life for years. The pain I felt was not for Richard's death; that hard, unfeeling man but for Josey, the woman who knew of no life apart from her husband.

As if to compound her wonderful ignorance, Josey died free of memory. Shortly before her death a routine mind exam went wrong and had nearly destroyed the electrical function of her prefrontal cortex and hippocampus. All knowledge of who she was appeared lost. In the days that followed the accident, however, she acted as though nothing had changed. She was still cooking, still cleaning, still smiling, even though she did not remember any of us.

The final time I visited her, she opened the door to her home and embraced me in the same fashion as she did before. Her kitchen was filled with the same scents and her hospitality given to me was exactly the same as when she knew who I was. I was sad but I introduced myself yet again and she welcomed me warmly into her home, insisting that I stay for dinner. It was a five course meal with excellent roast chicken. She did not dine with me.

The loneliness I experience feels heavier now that she is gone. She was not family even though my dreams would say otherwise. Behind the smile of Josey was the work of forgetting in pursuit of happiness, and I believe she ultimately got her wish. Are we any better?

The White Crow

2010-12-01T21:28:00.003-05:00

Author's Note: There. 50000 words done. Book isn't quite finished, though. Still some plot points to make, and a massive amount of re-writing and editing to do, but the skeletal plot is there. Here's another small taste for your enjoyment. I'll get back to a regular writing schedule this week. -J

_________________

The rumbling settled and in the darkness of the cavern Thyme reached into his pocket for his lighter. "Is everyone alright?" he asked, coughing, "Call off your names!"

The flame was small, and a cloud of ash still obstructed the cat's eyes. The sound of water could be heard, and the echoing of sound reached far across the dark chasm, giving witness to the size of the cave they had discovered. Thyme's assistant was the first to call out.

"Sebastyen here!"

"Sygfried, all fine."

"Abelard. A bit shaken, but well enough."

"Radcliffe here."

"And I'm here." spoke the Rain Reader.

Thyme nodded, satisfied that everyone was safe, but as he rose and dusted himself off, there came an unfamiliar voice from across the darkness.

"Ah, now there is a crow I haven't heard speak for many, many years."

Thyme turned the flame slowly, pointing it to the large dark expanse of the cavern. The others were silent, and Sebastyen turned to the Rain Reader. There was a glint of fear in her eyes.

"I am surprised you have made it this far. The gods work strangely..." the voice continued, "You will not find what you seek here, I'm afraid. But come, join me in the city square if you like. We have some things to discuss, Agent Thyme."

Thyme peered into the darkness, but the mouth of the cavern only opened into a giant black abyss. Some large shapes could be seen just beyond the reach of the light.

"Who are you?" asked Thyme.

"Come find me, and I will give you answers." laughed the voice, "Fear not, for I will not harm you. Come."

The group had gathered around the short reach of Thyme's lighter flame. The Agent looked at the Rain Reader steadily. He spoke softly, so that the intruding voice could not hear, "It sounds as if this voice knows you."

The Rain Reader bowed her head, her black feathers glinting in the fire light. She spoke slowly and deliberately, "If this voice belongs to he whom I remember then we are in no danger, as he said, but it great peril of losing our way."

"Who is it, Rain Reader?" asked Sebastyen, "To whom does this voice belong?"

"I believe it may be the White Crow, the leader of my clan. Though how he came to be here in this buried capital I know not."

Thyme took special note of her words. Among each member of his crew, he knew the Rain Reader the least, and any insight into her lengthy history was kept safety hidden behind those black feathers and amber eyes.

"Leader of the Rain Readers?" he asked, "I thought the clans had no form of government."

"Yes, that is true. But he holds spiritual prominence. He is the one appointed by the gods to choose each and every interpreter of the rain. He is the one that chose me so many years ago, and..." she paused, "he is the one who banished me."

Thyme held the lighter steadily, and caught Sebastyen glancing to him. What is it that those crow could have done to warrant banishment from her own kind and kin? The subject felt too large to undertake presently, and Sebastyen felt the same. He quickly changed the subject.

"What on earth would he be doing here?"

"I do not know," the Rain Reader responded, "but he is very dedicated to the gods. Some say he is even as old as they are, and that he cannot die."

Thyme decided, "Very well. It seems as though he knows of our quest, and may have information for us. We have to seek him out."

Thyme turned and began to walk into the darkness when the Rain Reader grasped him by the arm, "He will give nothing freely to you. He will seek to only grant you despair." she had a look of horror in her ancient eyes that gave Thyme pause. She was exasperated, almost pleaded "You mustn't go to him."

"It would seem as we have little choice, Rain Reader." keeping disciplined, despite the crow's uncharacteristic anxiety, "Our path behind us is now blocked, and I imagine this White Crow of which you speak knows another way to exit these caverns. We have to press on if we wish to leave." And with that Thyme moved forward with torch raised high. As he followed the path the others filed in behind him. The further they went, the more that dark shapes began to take form, and the buried city of Paris revealed itself. Even in that dim lighting of fire, the sight was magnificent; tall building of fine craftsmanship, ornate fountains that now run dry, intricate streets and paths, and large squares that would put Trafalgar to shame. This was clearly a city of great wealth, with a striving desire to uphold the value of beauty in all things.

At last, after walking what felt like several miles, the group came to a large opening with what appeared to be a great temple at the far side, still some distance off. Standing in the square in front of the temple was a solitary figure. As they approached, the figured turned to them, and Sebastyen let out a small gasp. It was a crow, undoubtedly, but only in form. The feathers of the crow were of the purest white, and his garb was a glittering gold and silver hung from his shoulders. In one wing he held a large white staff with leaves of gold, and adorning his head was a circlet of feather and spun silver. The crow looked at them and spoke slowly, "Welcome, travelers!" his voice was ancient but strong, "I greet you as a fellow journeyman and guide, as directed by the gods." The white crow began to slowly step towards the group. Thyme quickly removed his pistol and pointed it at the unknown figure.

"Speaking distance is close enough, thank you." Thyme commanded, "I have no desire to delay our mission, so we must put pleasantries aside. Tell us who you are and how you know of us."

"Much like your companion there, I have no name." the crow spoke wistfully, "But I do answer to the title of the White Crow." The Rain Reader shuddered. "And I know of you..." he pointed to the temple behind him, where the sound of falling water was heard, "because I was told of your coming."

"The White Crow... how did you come to be in this place, so far from any other living creature." Thyme asked.

"I am blessed by the gods," he responded simply, "and I have waited here a long time for you to come. Yes, a very long time. I know why you are here, perhaps I know better than you do. The gods have told me many things during my times of meditation here in this solemn and abandoned city..." his voice trailed as though he were no longer speaking to Thyme. The White Crow looked around at massive statues and walls of marble and stone, and it inspired a sense of nostalgia, "I feel a great many things have transpired since I left the northlands, since I left my home and my kindred." The White Crow turned to face them again, and pointed a single wing at the Rain Reader, "But look and see! My kindred have come to me! Have you come to seek redemption for your heresy, Fallen One?"

"I made no heresy, elder. I believe we need to spread our teaching if our clan is to survive."

The face of the White Crow grew cold, "Our survival is for the will of the gods to decide, young one. Not you. It was because of such narrow thinking that you lost your way... and were banished from our order. But I know, the rest of you have not come for her sake," the White Crow turned once again to Thyme, his pale red eyes glowing in the firelight, "I know you seek the cog, the symbol of the rule of the gods in this world. You will not find it here, but perhaps I can aid you in your quest."

"Why would you help us?" asked Sebastyen.

"Everything I do, I do for the good of the gods." the White Crow replied simply. "Come with me, I can show you the way." The White Crow walked into the temple, his voice echoing just above the sound of water.

The White Crow turned, and as he did Thyme noticed emblazoned on the back of his cloak a large seven-toothed gear, looking exactly like those found on the bodies of the murdered creature back in New London. Thyme shot a quick look to Sebastyen, who only nodded to say that he made the connection as well. Thyme's instincts told him that this crow was more than what met the eye. Thyme lowered his pistol and turned to speak to his companion.

"I don't like this, but we have little choice but to follow him right now. I suppose if he would try to get the jump on us, we still out number him. But its clear to me that he is keeping something from us. Stay close, all of you, and keep your wits about you!" Thyme moved forward, and the others followed, walking towards the temple in the distance.

As they got closer, the sound of water droplets grew louder and louder. As they approached the entryway to the temple, the Rain Reader stopped and tapped her staff, "I do not believe we should be doing this," she began, "He is not one to be trusted. We would have better fortunes on our own, without his aid."

In his heart, Thyme agreed, but he could see no other way. There was no telling how they would get out of the caverns of Paris, and the White Crow had information they might be able to use. Besides, the quiet nagging of the investigation back in New London reawakened in his mind with the appearance of the symbol of the gear. They moved forward into the temple, but the Rain Reader adamant, "I cannot go with you. I will not be subject to his will again."

Thyme relented, "That's alright. Stay outside and guard our entry. We will return for you after we have spoken with him." Thyme then led the group into the temple, with the old Rain Reader leaning on her staff outside the temple walls.

The temple interior was lit by several torches around a circular wall. In the center, the White Crow sat amidst a small ring of water raining from an opening above. The drops struck the ground with loud impacts and went into respective water drains to some reservoir below. As Sebastyen looked closer, he noticed that the drain made the formation of a gear embedded in the floor. Sygfried noticed as well, as whispered to Thyme, "Whatever this place was, it certainly once held a cog of prominence. The marks of the Ancient Ones are all around!" The White Crow, hearing the entry of his guests, raised his head and spoke, "Come, sit. I have a story to tell."

______________________

The Scholar

2010-11-22T20:59:00.003-05:00

Author's Note: Huff, puff, huff, puff. I've been doing a lot of writing folks. Book is currently at 36200 words. Closing in on that 50000 mark, but its just a draft right now. Feels good to get down, but I've realized that I write a lot of dialog. I mean, A LOT of dialog and I personally find that a bit shameful. Its too easy. In any case, here's one chapter. I've posted several here before, but this one's new. As always, enjoy and comments are welcome!

__________________

The Scholar

There came a loud screech as Thyme entered the Yonder's library deep within its metal belly, "Damn it all! I can't find a bloody thing in this gods-forsaken library! Have they never heard of a proper organizational system?!" Thyme entered slowly into the poorly lit room. Shelves were everywhere, some were rocking about and forth in a dangerous way. There were rows upon rows of books, many disheveled and lying about the grated floor and on the shelves. A faint whir of exhaust fans could be heard behind the present din of expletives. Thyme turned a corner to see a small alcove with a single lamp upon a large wooden desk. Suddenly, a flurry of brown feathers and two large globes with pupils popped out from underneath the table. Once the owl's beady eyes caught the presence of Thyme, he fell over right again with a new slew of swears, "Gods almighty! Who the hell are you, and for what damnable reason are you sneaking up on people?! You nearly ended my poor life with fright, you damn cat!"

Thyme was quick to console, "My apologies. To be fair, I had not expected an owl to jump out from underneath a desk. I didn't mean to frighten you. Gods know how we cats are with being scared."

"Fine, fine, just help me up." Thyme reached out his paw and the owl took a feathery grasp. As he rose, and stack of books which he had fell upon toppled over and let loose a great cloud of dust. Both creatures started into a fit of coughing and hacking, "Bloody bookkeepers! I doubt they've dusted this library even once! To think this collection was once the best animal library in all of the Union..." cried the owl, waving his feathers to clear the air. "Half these books are completely illegible now, what with all the terrible moisture and climate control here. That buffoon of a captain never cared about what was really important in history..."

Thyme thought to interrupt, as he assessed the complains of the owl would not end on their own, "I'm terribly sorry to bother your studies, but I felt the need to come introduce myself. My name is Thyme."

"Ah yes, the Agent from Human / Animal relations, how do you do?" replied the owl, not without a great deal of passive annoyance, "Would you help me find the book I dropped? I was looking for it under the table when I was scared to death my some fool who enters rooms without knocking."

"I knocked, sir, but there was no answer. Gods know I heard you when I came in though. I always thought scholars to be of... purer speech."

"Purer speech, eh? Let's watch you suffer the literary onslaughts of all living kind, while succumbing to the brainless dribble of countless students and unreasonable manuscript deadlines, and we'll see how pure YOUR language remains!"

"Fair enough." Thyme placated, "I assume you are Professor Siegfryd?"

"You assume correctly, though that doesn't convince me you're any less of an idiot." the owl began as he looked through another stack of books, "They say you were an Inspector once, though I find it hard to believe that the mind of any cat could solve a crime of even modest intelligence. Perhaps that's why you were fired, then?"

"And perhaps I am to wonder why such a well-respected and renowned professor such as yourself is stuffed into a skyship with a paltry library only to be neglected by all his colleagues." Thyme retorted.

The owl turned and smiled, "So! The feline does have fangs! Perhaps he has eyes, too. If you find a copy of 'The Machinations of Ancient Water Irrigation' do speak up."

Thyme only had to look for a moment, as it was at his paws behind him, "Here it is." He lifted the book, and it felt ancient. The pages were crackling and worn, and small bits of paper fell out as he lifted it.

"Careful!" yelled the Professor, "That book is older than all your nine damnable lives put together, and worth more, too!" He quickly snatched it away from Thyme and placed it carefully upon the lit desk. He slowly opened it, and gazed through his half-spectacles at its pages. Peering over the shoulder of the owl, Thyme saw that it was written in a lettering he did not recognize, though judging by the title, he surmised it was less interesting than the decorative characters implied.

Annoyed by the unwelcome viewer, the owl spoke, "Well, you've had your introduction Agent, was there anything else you might trouble my study with?"

"As a matter of fact, yes." Thyme replied. The owl sighed loudly, closed the book, removed his glasses and let them hang by the chain around his neck and turned to Thyme expectantly. Thyme paused a moment to look clearly upon this unknown member of his camaraderie. He was old, though perhaps not as old as the captain, and smaller. He had the scholarly look about him; worn and studious eyes, feathers that were more decorative than used for flying, even his clothing showed the distinctive marks of research on the elbows and vest pockets.

"Well?" said the owl.

Thyme met the gaze of Professor Siegfryd, "As the designated leader of this band and mission, I need to know my subordinates."

Siegfryd muttered in disgust, "Please. One of your subordinates I am not. I am here of my own free will and as a consultant. To be realistic, Agent Thyme, you need me much more than I need you."

Struck by the cheek of the owl, Thyme's curiosity was piqued, "Oh? And would you care to explain why?"

"Certainly, if you have the capacity to understand it. I am the only one on this ship who has been to the European mainland before, and I am therefore the resident expert on its workings."

"Indeed. And why have you been to the mainland before? Did the Owners send you on a different expedition?"

"Not in the slightest. I traveled there, Agent Thyme, to learn the unlearnable. To find the secret knowledge that has been lost for centuries," his eyes seemed to light a small dance as he spoke these words, "Where others were afraid to venture into the forbidden lands, I lept into them, and I tasted the wondrous fruits that they had to offer."

"What did you discover?"

"Much that is not meant for your feeble mind, cat." he exclaimed, losing the wanderlust in his face, "But it is enough to say that I know most of what there is to know of the Ancient Ones and their ways. I can translate twelve forms of their writings," he gestured to the book on the table, "And I am the best creature to help you find this Grand Cog that you are seeking."

"I see. And where do you believe we should look first?"

"Well, in the capital of the Ancient Ones, obviously." he began, "There was once a large bustling city in the lands of what is now called Old Germany. It was a center of commerce and government, so the cog is almost certainly there."

"Good. I will notify the captain of our destination. Do you know where the city is?"

"Unfortunately, flying there is only half the journey. I can lead you to the approximate location but we will not arrive by air alone. The city is far underground, I believe, deep within the desert that now covers most of Central Europe."

"I believe that may be why we were conscripted the services of Abelard, a Digger mole."

Siegfryd responded sardonically, "Wonderful. Another lesser mind to deal with."

"Enough." began Thyme, angered "I have had enough of your pride, Siegfryd. While your paltry insults mean nothing but your own inferiority complexes to me, I will not have you speaking in this fashion to anyone under my leadership. If need be, I'll throw you off this ship myself."

Siegfryd laughed, but noted the threat of Thyme, "If I've heard that threat once, I've heard it a thousand times..." replied Siegfryd, seeming distant suddenly. "Very well. I do know when to hold my beak."

"Good. Thank you for your assistance, and I think we will be needed more of your expertise." Thyme began to leave the library, and said in passing, "I believe dinner will begin in the mess hall in less than an hour, if you would care to join us and meet the rest of the team."

"I'm afraid I am not welcome in the company of the captain, sir, though I am not surprised he neglected to mention it to you." said the owl somberly as he sat back at his desk.

"What? Why is that?" asked Thyme

"You would do better to ask him, for I know not his reasons for banishment any longer. The old fool was always more stubborn than I."

"You speak as if you have a history between the two of you."

"We do, at least for my part. Its a life-long history. He's my brother."

___________________

Interlude

2010-11-12T21:45:00.002-05:00

Ladies and Gents, its National Novel Writing Month, and thus the reason for my lack of posts. I finally decided to get going on that ol' book I had been promising to write, and its coming along nicely. Close to halfway through. I may post some chapters here and there, but don't expect much of anything new for a few weeks. Be back soon.

-J

The Beginning

2010-10-29T22:49:00.002-04:00

Inspector Thyme awoke to the sound of the mail crow outside his door. His cat eyes adjusted slowly to the morning light. He was becoming old, perhaps too old for these early dawns. The mail decided to come just after sunrise today, of all days. It was the only day that Thyme had opportunity to sleep in, and his health needed it. He sneezed, fighting off the last bit of a cold that had swept through New London as the winter season began to roll across the country. The crow called again.

"Mail, sir! Special delivery!"

Thyme clawed his way out of bed. It was generally assumed that felines were the least hospitable upon waking, and today was no exception. Thyme answered the door tersely.

"How many time must I tell you birds? Just leave any package on the doorstep..."

"Beggin' your pardon, sir, but this package requires confirmation. Signature, if you please"

The crow handed Thyme a clipboard and small parcel. It was awkwardly wrapped and bound by loose twine. "What is this?" asked Thyme.

"Not sure, sir. Came in just this morning, marked urgent." answered the crow.

Thyme thanked the crow quickly, brought the package inside and bolted the door. He had not received an unmarked package before, though he often received mail from the Animal Division of the Yard. He decided to wait until after breakfast to open the package. Thyme created his usual meal of trout and coffee in the morning. His senses slowly sharpened as he ate, the smells of fish and hard taste of coffee beans quickened his body and mind. As he sat, his thoughts wandered to the recent murders of animals and to what the package may contain. He opened it in the middle of his meal.

Inside was a letter, also hastily prepared, and a pistol; a small, four-barreled revolver, specifically made for what appeared to be the paws of animal. Such weapons were made illegal by the Owners over a decade ago.

Inspector Thyme removed the seal of the letter and began to pour his eyes over the scribbles underneath.

"Inspector Thyme,

My name is Father Oppenhounder. I have some insight into the recent murders you may be interested in." That was the culmination if the message, short and enigmatic. As Thyme examined the package, there was no return address. "What in the world," thought Thyme. " Who on earth would deliver such a thing by post?" He turned his keen senses to the clues of the letter. Quick writings of a clumsy hand suggests the paw of a large dog, and a few lingering whiffs of dander belie the scent of a hound. The package must have come from the Poor Canine district, home to several parishes and synagogues. If this Father Oppenhounder was indeed telling the truth, he was right in the middle of the scene of the crime. Most of the murders had occurred in that very district, and the two surrounding.

Later that morning, Inspector Thyme entered his Yard office with more on his mind than he cared for. Sebastyen, his loyal but carefree assistant noticed. "You look preoccupied this morning," quipped Sebastyen with a slight tone of interest, "What's on your mind?"

"I received a package this morning" said Thyme, amidst sniffles, "it was from a priest, and I don't know what to make of it." Thyme handed Sebastyen the letter, then carefully revealed the revolver from his vest pocket. Sebastyen recoiled at first, and stared hard at Thyme. "I hope you know what you're doing with that." Thyme curled a smile and sat behind his desk while Sebastyen read.

"What does this mean?" he asked once he finished.

"I don't know. It smells suspicious. The writer claims to be a priest and is possibly a hound. There is little we can do, other than discover what priest hounds are in the Poor Canine district."

"The Poor Canine? That's where the murders happened. Coincidence?"

"That's what makes me uneasy. Either this priest knows something we could use, or this is a ruse, or worse still, a trap."

"Surely the killer wouldn't be so bold as to send you a gun in the mail."

"I'm not sure what to think, Sebastyen. For now we can only research. Do you have a file of parishioners in the Poor Canine district?"

"Or course! Right away." Sebastyen leaped form his chair, and quickly stepped out. Thyme breathed a bit easier, discovering the first moment in the day that he felt calm. Sebastyen was unprofessional at times, but had excellent resolve, courage, and most importantly, records. They would soon learn the identity of the mysterious holy sender, and the case that had been cold for weeks would finally show a heated trail. Thyme stuffed and lit his pipe, gazing out his office window to the busy streets below.

He blew a smokey puff. "New London..." he murmured to himself. "City of Owners and Animals. None like it in the rest of the free world, eh? Free for some, perhaps. Fear for the rest." The Inspector's mind traveled to past days, when he had first been recommended into the Investigation Academy, his first case (a domestic dispute involving stolen property), his promotion into the Yard by way of the Owners. His mind continued to wander until...

He suddenly coughed and chided himself. It was inevitable during these nostalgic excursions, that he would think of her, but for some reason, the memory always caught him by painful surprise. He sniffed and wiped his nose, upset to make his body vulnerable to memory at a time like sickness. Then, Sebastyen came bustling in with several files and dropped them heavily on Thyme's desk.

"We're in luck," he began excitedly, "While there are three hound-priests in the Poor Canine district, there is one with the name Oppenhounder."

"I see. Where is he?"

"13 Minor Square, just outside of East End."

"East End, eh? Crowded place, and a bit dangerous once the sun goes down. Very well. If we hurry and go by cab, we should find his scent before lunch."

"Splendid! I'll contact the Owners..."

"Wait, Sebastyen," Thyme paused. His instincts had been frequent and haphazard of late, but he still had no choice but to trust them. He closed the door and turned on his radio receiver. It was one of Stilmann's operettas, and perfect for stifling sensitive conversation if the volume was loud enough.

Sebastyen moved closer to hear, taking Thyme's hint at secrecy. "I'd prefer not to involve the Owner's yet. I'm not sure why, but these murders have a nasty taste to them... More so than obvious. Until I know more, I'd rather not get the Owners involved and risk sloppy investigation methods. The humans have no sense of propriety at crime scenes."

"As you wish, sir." replied Thyme, "But this may shed suspicion on you later on if we get found out."

"I know the risk, young one" responded Thyme. It was a phrase that Sebastyen resented. "Even so, the thought of the Owners being involved in the investigation now... It makes my hair stand on end. Maybe later, but there are too many questions now."

"Very well. Shall we go?" Sebastyen asked, grabbing his coat.

"Indeed." The Inspector began to step out, pausing only to pat the four-barreled revolved in his vest pocket. It was beginning to look like an eventful day.

The Case of the Girl and the Gods, pt. 2: On Murder

2010-10-25T21:04:00.002-04:00

*static* This is a recording by Dr. Eldrich Mendelson, day two with... I'm sorry. I should apologize to you initially. I simply wasn't prepared for the sounds you made, and so I misunderstood your meaning and became scared. While a scream may be what you understood me to suggest when asking your name, a scream is impractical and... generally, socially unacceptable as a name. Would you mind if I suggest one for you?

(silence)

I mean, I would like to suggest a name for you, something I may be able to call you during our time together. If you don't like it you can take some time to think of something.

... No, that's alright. It's just that no one has ever asked me something like that before. You can pick one.

How do you like the name Tiana?

(a small laugh) ... yes. I like it.

Good! I'm glad, Tiana. And you have a very pretty smile. I hope I get the chance to see it more often. I would like to talk to you about some of the things that have happened to you. First, do you know where you are?

... No.

You are in the Universal Asylum, close to the Central Planets. You are very far from where we found you first, where your home could be. Do you know why you are here?

I'm here because I am here.

(laughs) Yes, but that wasn't exactly my question. I should ask, do you know how you came to be here in the Asylum?

... I'm here because I... killed people.

(puase) Yes. We found you on a planet that was full of death. I am told you were alone and surrounded by bodies when they found you. Were you the one who did that?

... yes.

I see. Why did you do that, Tiana?

What do you mean?

I mean to ask what reason did you have to kill a planet of people.

I don't understand. They died, as all creatures must.

I believe that killing another person is wrong, Tiana. Death is a very scary thing to people, and while it is inevitable, most people like to experience life as much as they can. Killing people hurts others because it takes their life away sooner than if they were to die naturally. Do you understand this?

Yes and... no... I know I hurt people... but that's what I was born to do... that's what the gods tell me to do.

The gods? Can you tell me more about the gods that talk to you?

They talk to me when I sleep. They talk to me more when I'm awake sometimes. They keep me awake and they keep my alive. Like you said, I like to live, too. They say that I have to do things for them because no one else will, because no one else believes in them anymore. That's why I like the name you gave me.

Tiana. That is one of the old names of a goddess as I understand.

Yes. She's one that talks to me.

What sort of things do these gods say to you?

They say that I'm special. They use some words that I don't know... words like prophet, and wrath, and con... con-version.

Conversion, yes. That word is used when a person changes from one belief to another. Do these gods make you do things?

They don't MAKE me do anything! I love them... they're all I've ever known. I would do anything they ask.

I'm sorry. I have never heard the gods speak so it is difficult for me to understand your experience. You said earlier that the gods did things to you... they kept you awake, they kept you alive. What did you mean by that?

They gave me things. Like breath, and heat, and love... in a way. And they gave me the ability to... do the things that I did. They paid attention to me. One day, they asked me to rise out of bed, and to give death to everyone that I saw.

Give death? It almost sounds like they asked you to give a gift.

No... not a gift. But maybe a lesson. I think death is misunderstood. Like me, it just wants attention. Like the gods just want attention. Everyone I know thinks that death is bad and painful and awful. I think the gods wanted me to show them the good side of death...

The good side of death?

Yes. Death isn't really good or bad. It just is. Just like I am here, and you are there. Just like when you're thirsty, then thirst is there, craving your attention. Or when you're in pain, you'll always be in pain until you hear what the pain has to say. Then, sometimes, these things help you.

... Hmm. That all sounds very mature, Tiana. I do not disagree. Sometimes these hard experiences, like pain or sadness have something to teach us. But these things are good only because we can learn from them and continue living based on the lessons they have taught us. There is no lesson death can give that we can live through.

The lesson was not for them. The lesson is for those who heard the screams, who saw the blood, and how now feel the fear.

(silence) ...I would hope that the gods that you mention value each human life more than that.

(laughs) I don't think they do. They just want attention, like everyone else.

I think that's enough for today, Tiana. Thank you for being so honest and understanding. Shall I come back tomorrow?

If you like.

(end recording)

_______________

*static* Subject Tiana exhibited some interesting levels of self-awareness and capability, though disturbingly coupled with theological delusions. Her actions appeared to have been motivated by some divine mandate to teach the rest of humanity a lesson. Tiana showed some individualized desires and sign of autonomy and perhaps even guilt for her actions, and I'm hopeful that progress can be made to combat these delusions and 'gods.' It seems that she responds best to honesty and forwardness, though I have yet to witness the scope of this power that the Commander spoke of earlier. I must admit, part of me believes her to be simply a little girl and I have a difficult time envisioning her to be the 'magnificent weapon' the Commander wants her to be...

Untitled, pt. 3

2010-10-20T22:58:00.003-04:00

Each night at the hospital brought a new bowl of fruit and a new letter from the doctor, and sometimes even a video recording. They were often short: brief updates on relatives or some new machine they discovered that might help uncover new insight into... into my sickness. Ever since the bombs fell, the State has kept a close eye on technology and its uses, and even fewer people understood how they worked or what the ancient machines even did. The local clinics purged themselves of equipment entirely, relying more on natural and pagan methods to heal patients. But, in some dramatic cases, a person would be taken to the State Hospital for what was called "the Old Treatment." They would use all the old technologies to help someone important. Every device was rife with screens and blips and buttons and beeps. Apart from some of the small mundane contraptions, I had never experienced ancient technology, but it all frightened me a little. All I knew was that these things were somehow related to the almost-destruction of humanity, and like most people, I tried to stay away from them.

As the nights passed, more and more of these old technologies started to appear in my room. I was warned by Dr Kenning not touch anything, that they were there for my benefit. One was shaped like a giant box, taller than me, and would emit a small buzzing sound ever so often like it was full of bees. It had bright lights that illuminated in some syncopation, but I was unable to learn what they meant. I became curious one night and tried to open the box, with great difficulty; only using my bare fingers. I pried open the front of it only to discover a great mass of lights upon what appeared to be honeycomb protrusions and hard plastics. Immediately, it began to emit a high pitched tone and I became scared, so I kicked at the mass until it stopped. The next night I received a tersely-worded letter from the Dr, and he was none too pleased that I damaged his "device."

Some nights I would write the doctor and tell him how I was feeling, how I was bored with textbooks and fruit, how I didn't understand his latest chess move, and how I wish more than anything there was someone to talk to and to play with. Usually on those night I would just tear the letter to pieces from fear of appearing too needy or forward. I'm afraid I may have too strong of feeling for the doctor, but I do not think it can be helped. He's the only person in the whole world that I can talk to. He always responds gently, saying how he understands and that he knows what its like to miss someone deeply. He encourages me to stare in the mirror and to stare at the midnight sky, quoting that such practices "encourage self-awareness and mindfulness." As fond as I am of his idiosyncrasies, I've grown quite tired of the little girl in the mirror. Looking into it, I couldn't help but be reminded that I was the only one in the room. Despite my admission to chronic solitude, Dr. Kenning briefly mentioned how he was envious of me, and how he wished he could see the night sky once more. At first, the statement had caught me by surprise. How could he know what the Night looks like? Then my lagging memory jolted, and I remembered that Dr Kenning was an Elder.

The Elders were normal human beings that survived the bombs over three hundred years ago. There weren't many, maybe only ten or twenty, but no one knows exactly how many there are now. Something about their bodies changed when everything was fire and raditation. While everyone around them was dying, they survived, and soon they found each other and formed a community. The generation after them lived regular life spans, but the Elders lived on to see their children grow, and their children, and even their children, down now to the sixth generation, and even outlive them. They were worshipped for a time, and highly valued for their knowledge of the old ways. They were wise, and were the first to suggest the destruction of ancient technology and encourage simpler living more connected to the life of the planet and our local communities. The human race is only able to survive now because of their teachings.

I decided to take Dr Kenning's advice of Night-watching and took to staring at the stars. I was amazed at all the spots and dots and at how beautiful it all was. I had only ever heard of how dangerous nighttime was, but I never knew it could be so mystical and marvelous. I love the first moon the most, the white moon with the open maw and great big eyes. I began to speak to the first moon as a dear friend, "Hello, first moon. My name is Caraline, and you are my only friend that sees me while I'm awake. I want to tell you all my secrets and all my feelings. I don't mind if you cannot answer back. I only need you to listen to me and keep me company on these lonely night." It may have all been a bit juvenile and appeared quite silly at times, but I believe that's how I kept my sanity in those dark hours, talking to the first moon.

When the second moon would breach the horizon, in its pale red glow, I knew my time of wakefulness was almost spent. The second moon traversed the sky very quickly, and when it set was when I fainted, stricken with the day-sleep. But my restfulness during the day was often good, and my dreams felt more natural, like my eyes were closed with my spirit playing behind them.

Afterlife: The Quantum Democracy

2010-10-16T22:25:00.002-04:00

This all came as... a bit of surprise. Once you live an entire life: grow, get married, produce a lucrative career, see children, grandchildren, great grandchildren... Once you live an entire life as well as you can, you forget what it means to die, and the afterlife becomes more of an after-thought. So it came as a bit of a shock when my time came... and went. I remember I died, but then I didn't. I remember waking up just like after a wonderful sleep, but I was nothing. But I couldn't be nothing. Perhaps I just realized that I was... smaller.

As time, or whatever it was I used to call time, progressed, I learned that I was no long what I was before. I was still human, but in a very different capacity. I was part of something greater. As it turns out, when a person dies, they do not disappear, they only become smaller, to the size of a quantum, and participate in the community that is made up of all the atoms and quantums that made up your life. The human soul is really just billions of other lives who have died before. The collective emotional impulses, the sexual drives, the artistic inspirations... everything has happened before in the lives of others who lived and died in this world. All events are subject to collective agreement, from your career choice and choosing the person to marry, all the way to what you had for breakfast this morning, or even if you chose to have breakfast at all. The soul is a democracy on the subatomic level, and once you die you become like the community of souls that made up your life and what's better, you get to meet them. Each and every one of them.

I remember waking up after dying for the first time. Einstein was staring down at me, and he commented that I sleep too much. I rose and stared at him in amazement, and I realized I was surrounded by people who were long dead, but people I had admired and despised. Presidents, icons, popes, peacemakers, philosophers, artists, athletes... many of them quite famous and their works were well known to me. But those were only the ones I recognized. There were billions more, billions whom I had never seen, but who I would soon meet and begin life with. For what seemed like centuries after my waking I learned who these people were that made up my life, I laughed with them, cried with them, loved them, disagreed with them, plotted against them, made fun of them, flattered them, flirted with them, even married some of them... but in the end we all learned to live together. No one could die in this life, and no one was separated.

There was no lack of resources in this existence. Much to my amazement, whatever I wanted was provided for me. I had only to imagine something, and there it was. If I wanted to learn how to play the violin, one would magically appear before me, and a nearby person would immediately offer to give me lessons. If I wanted a stiff drink, a bar would materialize and as I entered I would be greeted with cheers of friends I had never known, along with the best scotch I have ever tasted. I openly wondered how this was all possible. Einstein tried to explain it to me once, something about living on the brink between matter and energy, where will and life are all that matters, but I soon stopped asking questions and just enjoyed my lot.

I had once asked Spinoza how it was that he came to be a part of my soul as opposed to anyone else's. "Surely there was someone else more worthy of such an intimate and grand possession?" I remarked. He laughed and answered, "My dear friend, it is not only you I am a part of and besides, I do not chose who to 'possess.' My body split into billions of pieces, infinite quantums that spread throughout the world and entered into the lives of many others. I am not only here, but also a part of your wife, a part of your children, and your great grandchildren. Just as they share a thread of your being, so they share a thread of mine. My voice and my influence may not be as large in their story as it is in yours, but that matters little. One day we will all come together to build a great city, and we will live in peace, together, as a part of god."

I loved this life after death that my companions showed me. I learned more about everything, everything that life could offer and I had such willing teachers. I even began to perfect my own story and its telling to others, as some small way of giving back. Then it happened that one day, there was a gathering like none before. It was a giant banquet, where all those who had formed my life and whom I had gotten to know so wonderfully well came together to feast. The light was brighter then, and a great table filled a giant hall. Everyone was there, and in the midst of the food and festivities I turned to a nearby companion and asked, "What is all this?"

"Its a celebration!" she exclaimed, "Someone is about to be born!"

I learned that it was now time for the community to come together once again, with me as the newest addition, to form a life. There was a joyous outcry as the light began brighter, and a great wind rushed through the room and with it, a baby's cry. So many laughed and cheered, and they're echos rang in my mind as the light grew to a blinding intensity, and then... the baby was born.

I now live as part of someone else. Our community continues to thrive, and while we are quarrelsome from time to time, we share an admirable peace. All the griefs and joys this child has are shared through each and every one of us in our own unique way. Its magnificent to see the spectrum of human emotion expressed through billions of quantum souls, one comforting another's sorrow, one celebrating another's happiness, one quelling another's wrath... And from time to time, the child encounters another community of souls, and in the sharing of life that they have, I encounter myself, a mirror quantum in another person's body. I'm told this happens from time to time, and that I should take advantage of the opportunity to interview my own experiences, but I find it is better to just sit, to be with myself and the others I have met, and to be present with this quantum life that is greater than any afterlife I could have ever imagined.

Back

2010-10-13T21:52:00.002-04:00

Ok, everything should be back on. I promise I'll have something by the weekend. Thanks for the patience all. And the new condo is amazing. As well as the cat.

Interlude

2010-10-05T22:17:00.002-04:00

Dearest readers,

As some of you know, I am in the midst of moving into my new home. That is the cause of the recent lax in posts, and the absence may last a bit longer. Getting internet in the new place is turning into an affair, and not the fun and devious kind. Rest assured that I am still writing, and hope to be back on within a week, with new surroundings to provide inspiration!

-J

My Oracle

2010-10-01T23:02:00.001-04:00

Author's note: Recently, one of the patients that I had met in my very first week at the new job died. She was extremely sweet and I felt the inspiration to write about her. This is a story dedicated to her. The given name in the work is not her, nor is the profession of the main character my own. Hey, a guy can dream.

__________________

Like all myths, the story of the ancient Oracle contains a kernel of truth. From that truth, many grand tales have been spun of heroes and heroines seeking clarity, risking life to beseech the all knowing Oracle for a gospel of truth. Often, the message of the Oracle was enigmatic and disappointing, leaving the hearers in a higher state of confusion than hence they came. It would only be some future event or insight that would give the Oracle's words meaning, a ring of truth that was impossible to understand in the moments previous moments, but had profound revelations later on. It was this mystical nature of Truth that carried the stories of the Oracle into legend, and with each retelling the Oracle would become more grandiose, more wise, and more befuddling.

There is, of course, no such thing as an all-knowing Oracle spouting the answers to life's questions in poetic phrases, but I believe that there are oracles, persons who, in those common moments when life seems without purpose, give new insight that inspires meaning. In reality, there are many oracles, but they are different for each person. When a man or woman is born, a charge is given to another human being to be their Oracle. They are unaware of this charge, and there is a good chance that the two will never meet. But if they do, they fulfill their roles perfectly: the Oracle bestows truth and the hearer receives it, perhaps not understanding its meaning in the moment, but the words are enough to drive them to seek a deeper meaning and purpose.

This is the story of meeting my Oracle.

I was all too green upon graduating from the School. I wasn't particularly distinguished among my peers in rank or skill, but my profession was a noble one. I was trained in the art of medicine, and I proceed to secure a modest position at a hospital in a more rural section of the planets. My new employment caused something of a stir in the local community; a fine, young doctor from the Central School was coming to cure the ills and usher in a new era of excitement and hope to a planet that had seen one too many natural disasters and epidemics. The most recent disease nearly rendered the planet uninhabitable were it not for the quick action of the planet Senators. They called in many political favors to procure the necessary supplies and medications for the people, but it cost two of them their posts. Alive but jaded, the people of planet Horion had all but given up hope. That is when the planetary hospital received my application.

I applied to that specific hospital not because the money was good, or for the location. In fact, it was relatively standard income, and it moved me farther from family. No, my reasons were more idealistic than that. I tended to pride myself for my compassion and it was here on Horion that I saw the greatest need of care. Unlike some of my colleagues, I was not terribly obsessed with a desire for a perfect record. Many of my classmates boasted more of their low mortality numbers than of lives they saved. I had one notable classmate who refused patients entirely unless it could be proven scientifically that their survival rate was at least 93%. I believe he only treated one person his entire junior year.

As for myself, I have lost many patients. Death has never troubled me; I find it to be perfectly natural and sometimes, in the right context, a beautiful event. I like to think I have felt more with my patients, more sadness, more joy, more despair and hope than some of my fellow graduates. These sentiments are awfully judgmental, but I find they are apt more often than not.

Shortly after I arrived on Horion, my role as the inspirational idealist was immediately put to the test. I found that the hospital had terrible conditions; unreliable supply lines for medications, drifting workers that would often be absent, too few beds for too many stricken... It was more than I could handle. There was one other doctor, Jasper, who only worked part-time. He was responsible for "showing me the ropes" and provided a small wealth of knowledge for treating this poor planet.

"You will start to develop a keen sense of who can live and who can die," he would say, without so much as a pang of conscience. "Save your skill and supplies for those who can survive. Do what you can for the dying, but our work is for the living. We don't have much in the ways of saving lives, so we must make do with those who have the strength to fight as we try to heal them." While it would have been easy for me to disregard his words as dreadful, there was a certain pragmatic character to them that could only be attained through painful experience. I began my orientation under Jasper's tutelage, and we set out to save the planet.

Practically speaking, it was more effective for the doctors to scour Horion and perform house calls, that ancient and forgotten art in medicine. Jasper took me into several homes in my first week, showing me the sheer breadth and tenacity of the plague that had crippled the planet the year before. The disease showed no signs of discrimination; young or old, rich or poor, wise or ignorant, they all succumbed to its ravages. The vaccination had long been developed, but getting it was expensive, and the most recent strain of the plague proved to be somewhat resilient. Just as the planet was starting to make a turn towards health, the fear of a second wave of the plague across Horion was quickly coming true.

After a few visits, Jasper judged that I was competent enough to go out on my own. I objected, citing my ignorance of planetary customs and locations of settlements as reasons for his continued observance. He only laughed, threw a planetary locator at me, and left. That was a humbling moment. I had come to realize the hollowness of the ideals i had. My desire to truly help those in need, my judgments against my classmates, my sense of moral superiority... all vanished in fear. In that moment I desperately wished I had kept better mortality numbers, that I had applied to more Central planets, that I chose instead to specialize and pursue a doctorate at the School. But it was too late. I could do none of those things. I could only climb in my craft, punch in the location of the next patient, and wonder why I made such idiotic choices.

Soon, I came to a small home on the outskirts of the main continent on Horion. I exited my craft, and was greeted by a fellow hospital worker that had just seen the patient. "She's inside." she said, rushing past to a craft of her own. I turned to say something, perhaps ask for some consolation, but the worker had already left. I stood there, at the threshold of the home, and wondered if I had not made some terrible mistake in coming to Horion.

I entered, and found an old woman, seated and smiling. She had a great hunch, her eyes almost level with her shoulders with her elbows splayed out beside her, rather haphazardly. She shook slightly, but didn't seem to notice.

"Hello. Are you Mallory?" I asked tentatively. She gave no response, but only looked at me and smiled. Her grin revealed several missing teeth, though one stuck out prominently from her lower jaw. She had a kind face, but it was worn and loose, like great volumes of life had been taken from what was behind her cheeks.

"My name is Jacob, I'm your new doctor." Still no response. "I've come to check on you." She only looked into my eyes. There was no light in them. They still functioned to provide sight, but they only communicated a pleasant confusion to any who saw them. I was able to give a quick glance to her chart placed beside her. Diagnosis: end stage Tramaculosis. She had been infected with the plague, and it had destroyed her brain. She could no longer speak, at least, not coherently, and she had forgotten how to eat. There was no telling her level of awareness or understanding; some of the more learned sick continued to write even though their other faculties were abolished. Judging from the make of Mallory's home and her personal effects, she was clearly poor, and it was doubtful she could read, let alone write. But it was only fair to ask.

"Can you understand me, Mallory? Are you able to read or write?"

Her face was void of understanding, but it still held the smile. She was so simple... she had no care save one: that there was another person present in the room with her. I sat next to her to check her vitals and organ calibration. As I tinkered with my tools, she leaned in close, her fragile body feeling the warmth of another close by. She then took my hands in hers, and she met my eyes and smiled larger. Still shaking slightly, only breathing and seeing, Mallory began to speak to me. She did not use words, but she had somehow captured my attention and began to communicate in a way that was ancient, subtle, and intimate.

In that moment I froze and understood that she was human, no different from me. She was alive, or perhaps had lived her life far ahead of me living mine. Her eyes were still kind... perhaps out of pity? An understanding of all the years waiting for me? But she only grinned innocently, then took my hand and brushed it softly against her cheek. Her eyes closed in satisfied peace. I thought her such a child, wanting nothing but the feel of a smooth hand against her face.

I left there shaken. What I had just experienced was nothing but a routine examination of a patient who could not be saved from death. But it felt like so much more, like I was reminded of something important that I had forgotten, but just as I remembered it, the memory faded again. Dreams are like this, I wondered, and I stumbled to my craft in tears. Why was I crying? Was it the fear of such age and mortality, or the naked simplicity of pure love that needed nothing but a hand to hold? I felt as though I had encountered both a great and terrible god, as well as a plain and pure babe. Separate, a man of courage could confront the god or nurture the child, but together... together such a creature would inspire the horror of unenlightenment and awe.

Shortly thereafter, Mallory died. There was another doctor on-call to make the pronouncement, and I never saw her again. My mind often drifted back to that holy moment, when Mallory was both so much greater and so much lesser than anyone I had ever met. It took me some time to realize, but my doubts in vocation disappeared with that visit. I know that I am here on Horion, doing work that I was meant to do. Its still difficult, and there are days when I want nothing more than to go back to the controlled environment of the School, but these people need me here. No... its more than that. I can't easily put it into words, but I need this place just as much as they need me. Mallory showed me a different way to be valued, one completely separate from the doctor who I thought I was. I just needed to be there, and she just needed a hand to hold.

And without ever saying a word, Mallory spoke the very thing I needed to hear. That is why she was my Oracle.

The Clocktower

2010-09-26T22:20:00.003-04:00

Author's Note: In the midst of a busy weekend of painting and other moving responsibilities, I found a small hour to write this piece. It's not much, barely even grown once out of my mind except for a quick spell-check. It represents an exercise is story writing, as I am still unfamiliar and unpracticed in the art. Should anyone know of any other forms of literary exercise, I should be grateful to hear them

The chimes struck three in the afternoon. Off by seven thirteenths of a second. There are none in the city that know or care about such a discrepancy, save but one. But then again, it is the job of the Timekeeper to care about such things.

My name is Abelard, and I live in the clocktower. My duty is to make sure the chimes are always on time and to see that the mechanisms run at peak efficiency. Just as my father before me, and his father before him, I was trained in horology from a young age, brought up to carry the pledge of seeing that the city runs on time. I am not the last of the Timekeepers, though I fear I may be the next to last. My son, destined to continue the work I have done, is an idiot.

I do not use the phrase lightly. He truly is absent of any mind for common sense, let alone clockworking. His heart is in the right place, though it takes more than heart to see the logic of the gears and escapements. He's still constructing his mechanisms at an amateurish level, showing no signs of originality or imagination. To him, every clock is just a mystery. He cannot wrap his mind around the ticks and tocks and clangs of a regular pocketwatch, let alone a magnificent work like the clocktower in which we live. I had hoped that moving into the tower itself would have inspired him to work harder, but he continues to make the same mistakes over and over. His calculations are haphazard, the gears he makes are shoddy and unsymmetrical. Even the bell-works he's created sound terrible; he has no ear for chime music. I'm afraid the country will soon lose an art, even though it would break him so to have such a failing.

Poor Daniel. He was hopeless before he started. Did you know that he decided to make his very first clock out of pure gold? It was an ostentatious project, to be sure, but it warped far too easily. The mere weight of the pendulum caused the clock to lag and cease functioning altogether after only two days! He had wasted nearly two months salary, not to mention the a blatant disregard for wisdom of his father, creating such a disaster. But he always did have a way of dreaming large. That's why I had hoped that standing in the largest, most famous clock in all the world would goad him into a more practical dream. One grounded in the reality of clocks; one of math, of consistency and discipline. But so far it has not, and it appears I was misguided.

The clocktower's discrepancy was no doubt due to one of Daniel's oversights. He may have forgotten to clean the driving gear. Dust builds up in as little as an hour, and a collection of the stuff can cause too much friction on the gear teeth. I'm proud to say that the city has never had to replace a single component of the clocktower since it has come under my care, but I don't think that claim will last much longer. I am old, and I cannot move and hear as well as I used to. There once was a time when all I had to do was sit in the clocktower for a few moments and listen. She would tell me everything that was wrong with her: the clicks and whines meant an unpolished gear shaft, a moan could mean an overwound power cog. Every problem would be revealed in the myriad of music that the clock would make. It was partly designed that way; it would be impossible to find any one of the millions of things that could go wrong with the clocktower. But all the sounds do no good if they fall upon deaf ears.

I am dying. I have done my best to chronicle of knowledge of the clocktower and its methods in several volumes located in the study. They are sizable, but I trust that anyone who can read them and understand their contents should be able to effectively care for the clocktower until such a time when replacement timepiece is required. I've instructed Daniel to petition the city for a new Timekeeper, and have given him the keys to the tower itself. I can only hope that someone with a bit more wherewithal and natural inclination for the science of clocks will take up the mantle. In the meantime, I will sit and listen to the music of the clock and sit with my boy. These are all the things I have left in life, and while they couldn't be more different in caliber, I love both them dearly.

The Whordgen's Secret

2010-09-22T22:17:00.002-04:00

As the skyship returned to the harbors of New London, there was a large contingent of humans awaiting them. "Looks like yer welcoming committee has been awaitin', friend." Captain Radcliffe noted. News of the discovery of the Great Cog had already reached the ears of the government it seemed. It was too much for Thyme to hope their return could be secret and unnoticed, but this meant there was a traitor among their friends. Thyme couldn't bear to think that anyone would have betrayed them, but the truth was evident. Over two dozen soldiers was proof, and Malcolm was among them. Before they could even disembark, Owner Malcolm had boarded the Yonder with government soldiers armed to the teeth. Sebastyen, in usual vigor, was the first to complain.

"What is the meaning of this, Malcolm? There's no need for such show of force. We aren't even armed."

"I beg to differ, cat. You are armed with your lies and your secrets." Malcolm spoke with the air of pride, "You thought you could slip through our skies with our knowledge? Your friend Thyme there has already shown himself as untrustworthy, and we can't leave something as important as the Great Cog under his devious claws for any longer than necessary. Mr. Thyme, if you will do the honors and bring me the cog."

The crew all looked to Thyme. He stared directly at Malcolm, knowing his friends would be killed if he resisted. All he needed to do was give Malcolm a reason to, but he saw that he had lost this battle. Thyme said begrudgingly, "Do as he says." Radcliffe shifted weight from foot to foot, showing his reluctance, and then gave the order, "Fetch the cog, Riggins." Riggins immediately left, giving Malcolm a sour look as he past.

"No good will come of this, Owner Malcolm." Spoke the Rainreader. "Your pride will be your death, and the death of many innocents."

"Your kind may have had the privilege of prophecy and speaking to the gods at one time, outcast crow," retorted Malcolm, "But because of the impurity of you and your ilk, you've lost your favor. Humanity now has the faith to speak to the gods themselves. It is from their words alone that we hear of death or salvation. Or have you forgotten how you ended up on this ship in the first place, a disgrace to your own fallen tribe?" At this the Rainreader fell silent, but he maintained his warning gaze.

Riggins returned with the Cog slung on his back. It still was turning and burning dull red. He placed it at the feet of the Owner, who raised its holding post to look upon the scribbles and symbols written on its surface. "Surely, this is the one." Malcolm let out a small gasp and his eyes widened. "This is the cog that can power the Whordgen. Finally, we can join our creators in the heavens." It was then that Sebastyen noticed another among the Owner's company. Beyond the legs of the soldiers, there was a fleeting of white fur. "Angel?"

The name caught Thyme's attention. The company looked back to see Angel, head lowered but still dignified, like a thief caught in a trap but refusing to confess.

"What are you doing here?" asked Sebastyen.

"You wouldn't listen, my love. You left to side with him," she said, looking to Thyme, "and that is going to be the end of you. They wanted to kill you, Sebastyen, and I couldn't bear to see that happen, to see you buried. So I fought for you, I did everything I could to keep you safe..."

"What do you mean? What have you done, Angel?" Sebastyen asked.

Her breath waivered. But Thyme knew, and she didn't need to speak. The traitor had revealed herself.

"She betrayed us, Sebastyen." Thyme said simply.

"But she speaks the truth!" injected Malcolm, "Se fought for all of your safety, and I am a man of my word. I will see that no harm comes to them." At this, he raised his hand and the score of pistols and rifles raised with it, pointing at the crew.

"This is a strange way to assure us of safety." Said Abelard.

"As I recall, I said we keep you safe, but we can't have a crew of betrayers to the state galivanting across the skies of the country, spreading lies and false histories. We are commandeering this vessel."

Captain Radcliffe leaped forward, "You can't do this! I've serv'd the majesty fer years! I've proven my blood time and again!"

"So you have, Captain," Malcolm calmly replied, "and the country is grateful of your service. That is why we are letting you and your crew live. But as for those who are not the crew..." he turned to Thyme and Sebastyen, "They are to be taken into custody, pending the rulings of the sacred courts."

Sebastyen looked to Thyme, and Angel stepped forward. This move was only too predictable, but there was nothing they could do. It was obvious that Angel had exposed them and their return. Any chance of escape had evaporated. Sebastyen had the fire of fight in his eyes as if to say, "Come now, we've fought out of a greater rabble than this," but Thyme stretched out his paw. This was not a fight they could win. Even if they were to escape, there would be no stopping the waking of the Whordgen, and it was possible that capture would present new opportunities for them. Thyme would need Sebastyen's strength and courage if they were to continue to rebel.

"Very well, Owner. We turn ourselves in peaceably." Thyme said. The crew rose to their feet in protest, but one look from Thyme quelled them. He looked to Sebastyen to follow suit, and they both stepped forward and had their paws bound.

"There's a good animal. Now, if you will all be so kind as to disembark my new ship, me and my men would be grateful."

Angel could not remain silent, "You promised me that they would come to no harm!" She moved to clasp Malcolm's arm, and he quickly removed a pistol and pointed it straight at her.

"DO.. not touch me with those... flithy furs." Rage was in his eyes, but it was unequaled to the fire in Sebastyen's. Thyme acted quickly and stood between Malcolm and Angel. "Enough of this! There is no need for violence. You've received what you came for. Let the others go."

"You're right, Thyme," Malcolm returned his pistol, "I've no need to sully my new ship with lesser blood. Come along." As they left, the crew of the Yonder watched them go. Angel, visibly shaken with fear and despair began to realize her mistake in trusting Malcolm. Sebastyen turned and said to Radcliffe, "Take care of her, captain. Don't judge her, but keep her safe."

"Aye, lad. You 'ave my word and my honor."

They walked side by side off the ship, Thyme and Sebastyen. Thyme's mind struggled to think of a way out of the situation, but his thoughts always returned to all the other moments that Thyme found himself in distress. Always Sebastyen was by his side, always with no hope to be found, yet they had somehow prevailed to this moment. Through luck, through kinship, through sheer stubbornness they found the strength to survive. Thyme couldn't help but let out a little laugh.

"I would be obliged to learn what is so humorous about our circumstances, sir." Said Sebastyen dryly, noticing Thyme's all-too-rare jovial disposition.

"We always seem to find ourselves here, Sebastyen. Hopeless, naught but our wits and heartiness to save us. Cut off from friends and familiar places. I'm starting to think we like the idea of dying, but can just never get it right."

"We may not have to try much longer, sir." replied Sebastyen, "This new lot is beyond even my strength to fight. He is too vile, that Malcolm... What can we do in face of such blind and malicious conviction?"

"Hope is all, my young friend." Thyme reflected, "We may feel alone, but even our feelings can sometimes be less than truthful. I would place our hope in our friends yet."

"I'd rather have my hope placed in my own claws." Sebastyen rebutted, "I'll see that Malcolm pays for this myself. No one points a gun at my Angel and gets away with it."

Thyme was tempted to remind Sebastyen of his love's betrayal, but even he knew that wasn't right. Angel was working to save their lives and besides, Thyme had learned through experience to refrain from challenging the love of Sebastyen. That anger may serve to help them yet, when the moment becomes right.

_______________________

Malcolm could not help himself. He sent word to Cylith to meet him at the Whordgen. He was going to see what this vehicle was, and he was going to find out that very night. He was the prime candidate for piloting the craft, and he wanted to see its lights, feels its hum, get to know what the steam of life did within its sheets of bronze and gold. Within the hour, Grand Cog in possession, he stood before the Whordgen with Cylith, hands quivering in anticipation.

"Are you sure this is a good idea?" Cylith commented, "You have no idea what will happen, and while I believe the prophecies as much as you, I would be a bit more comfortable with an army behind me if this thing wakes up swinging."

"Don't be so pessimistic, Cylith. It isn't becoming of a woman of your position to be so... doubtful. I'm not going to pilot it, I just want to sit in the chair a bit... assuming there is a chair. Besides, you're here to go get help if anything goes wrong."

"Lovely. Be sure not to touch anything, even if it look innocent. Fine, here's the cog-space." Cylith removed the outer plate, revealing the core of dark emptiness, waiting to be filled by the cog that would be its heart. Slowly, Malcolm lifted the red cog and placed it into the space. There was a small click, and several gears began to lower into place around the Great Cog. Through processes of steam and whines, the hum of machinery coming to life could be distinctly heard throughout the promenade. The eyes of the Whordgen opened, and its lettering on its breastplate lit a bright, fiery red. Slowly the Whordgen lowered itself and with a great crash of weight came to rest on its hind legs, waiting for its master pilot.

"Well, there it is. Its awake. Now what?" asked Cylith.

"Help me look for the portal leading inside. Perhaps its around the back..." They circled the great beast and could find nothing. No hole, no ladder, no stair leading to the pilots quarters. Nothing. "Perhaps it isn't supposed to be manned? Perhaps it responds to verbal commands?" Malcolm wondered aloud. He began to shout common machine commands, "Open!" The Whordgen remained still. "Awake!" Nothing. "OBEY!!" Still nothing. "Damn it all! We solve one puzzle just to find another..."

"Wait a moment" said Cylith. "There, behind the right foreleg." Hidden just above where the right paw met the floor was a small golden ladder that reached up to an opening. The Owners peered into it, and it looked to stretch in gilt and gold all the way up into a space behind the Whordgen's eyes.

"Well this must be it, but it looks a little tight..." Malcolm began to climb the ladder to the opening. To his dismay, the size of the hole was too small to fit his frame. He struggled and grunted, attempted to find some way to fit through, but it was clear that even if he could, the rest of the journey up would have been too constrictive. Malcolm soon gave up and returned to the floor, where a giggling Cylith watched.

"I don't understand. This is clearly the portal, but only a child could fit through that hole. I can't imagine why the Ancient Ones would make a machine so large and sacred to be piloted by a child... What are you laughing about? I didn't see you try to help me..."

Cylith was now laughing hysterically. She was gripping her sides and shaking her head while looking at Malcolm. After some moments she stopped laughing with a sigh and began to walk away when she noted, "Malcolm, poor Malcolm. You were always such an idiot, such a fool..."

At this, Malcolm raged, "How dare you!? Did you forget that all this is only possible because of me!? We are at the dawn of a new chapter in human history, and all you can to do is insult me!? I'll have you buried before the sun rises on..."

"Calm down. I was only observing your inability to see the truth."

"Truth? What truth? What are you talking about?"

"Malcolm, this Whordgen may be a new chapter in history, but not for humanity. It was made to be piloted by an animal."

"What..." Malcolm froze as his mind wrestled with the notion. How can the greatest discovery humanity has ever found, the Whordgen, the vehicle for the ascension of man that was referenced time and again in the prophecies, be mastered by an animal. "This is impossible. There is no way that this..."

"An animal is the only thing that can fit through a portal that size. Its not unprecedented; many of the old devices were made to be piloted by animals. Just never anything this large..."

"Or this sacred!! I won't have it, I won't have this machine of the gods be desecrated by animal paws!"

"But look at it, Malcolm. Its very form is a unique combination of human and animal. There is some historical evidence that humans and animals once worked together."

"You mean animals once served us then revolted."

"Yes, fine, served and revolted, but perhaps this was made before then." She looked to Malcolm, who was visibly torn by this moral dilemma. "Malcolm, don't be so pessimistic. It isn't becoming of you to be so doubtful." She smiled, "As I understand it, you have two animals in custody awaiting execution, and one animal who will do anything to make sure they live."

At this, Malcolm raised his face. "Angel? Are you suggesting she pilot the Whordgen? I won't have it!"

"I'm not sure you have any other choice, Malcolm. You have the entire city of New London expecting the awakening of the Whordgen and the 'ascension of humanity' in only a week's time. But it's a simple enough problem; she will agree to follow your every word, as long as the Inspector and his assistant come to no harm."

The proposal infuriated Malcolm, but he knew he had no choice. For years he dreamed of piloting the Whordgen, to lead all humanity to the ascension that had been foretold and be the first to taste the air of deification. But now his dream were destroyed by a portal too small. The gods were testing him... obviously in their mercy they decided it was important for humanity to learn to live with the under-creatures enough to work together with them. So be it. Malcolm decided that he would arise, become greater, and extend the honor to those who were lesser. Angel would pilot the Whordgen, and he would pilot Angel. This would have to be enough.

Untitled, pt. 2

2010-09-20T21:36:00.003-04:00

When I awoke, I found myself in an unfamiliar place. The door was locked, but it didn't matter. I was frightened and didn't know what to do. This must be the State Hospital.

I hardly moved from my bed that night. I suppose it was childish, but I lay beneath my covers, hoping beyond hope that there weren't any other creatures in the room with me. Why is it that new surroundings and dim light causes the mind to conjure up the most unreasonable fears? Be that as it may, I could swear that all the sounds and hums of that room were magnified a hundred-fold, simply because of my unacquainted knowledge of their origins.

Once I drew up the courage to at least rid myself of the covers (due to my anxious and increased temperature) I decided to catch the bearings of the room I was in. There were four high walls, a small writing desk opposite the bed, a low table with what appeared to be a bowl of fruit, and a giant mirror on the wall facing the door. I stared into that mirror for a long time. I began to wonder about the girl on the other side and how plain she looked: long black hair and eyes that said too little. A nose too small. Cheeks too big. A chin that was just shallow enough to criticize. The children at the Academy were always generous with insults, and they could be quite clever. I wonder what they say of me now?

As my bravery continued to build I noticed my boredom and hunger were also on the rise. I stepped lightly from my bed and approached the bowl of fruit. It was brimming with fresh delicacies and as the hours passed so did each apple, orange and grape. They were the only things that gave life to that room that night. I savored every bite, every piece, every peel. I don't think I had ever been so purposeful in eating a piece of fruit before, but that first night in the hospital it was the only thing that had connected me with the old way of living, with home and with family. I began to cry a little. I must have looked very silly, savoring a piece of strawberry while fighting back tears, but I couldn't help but wonder if I would ever seen my family again. I was far too young for such a sad thing to happen to me; that's what my tears were saying.

It was then that I noticed a letter on the writing desk and a book, one of my old textbooks from the Academy. The letter was addressed to me, with the simple and formal rendition of my name, "Caraline."

To Caraline or, the One Who Sleeps During the Day:

No doubt you must be terribly confused and frightened. Let me assure you that you are in good hands. Your parents send their love and kind thoughts, and I'm told your brothers and sisters are asking about you constantly. Unfortunately, we haven't had much to give them in terms of information, but I am confident we will learn what has happened to you soon enough.

My name is Gerald Kenning. I am a Doctor of the State of New India, and I specialize in Neurogenics and Natural Medicine. You are in the State Hospital in the capital of New India, and have been here for several days now. As you may already be aware, you do not wake up when the rest of us do, and you are possibly the first human being to see the night sky in over three hundred years.

I've named your particular condition "Night-walking." While the rest of the world suffers from Night-Faints, the condition where an individual falls asleep immediately as the Night comes, you wake up. As we are not yet sure as to the causes of Night-Faints, your condition of Night-Walking is a complete mystery! Still, that does not mean your stay here in the hospital should be anything less than luxurious. We have left you some items to occupy you this evening, including some fruit from our private gardens. I hope you enjoyed it, I assure you its the freshest we have, and it is completely healthy and nutritious, free of any radiation. We will give you more each night. Be sure to eat it all! We don't want you starving.

I have also left you one of your books. I apologize for locking you in your room, but we must make sure you stay in a controlled environment as we monitor your condition. I will try to get some paper and writing utensils so that you may in turn communicate with us, but I hope this book will keep you occupied in the meantime.

We don't know why this has happened, or why this has happened to you, but we are diligently trying to discover the answers. Know that you are loved and cared for.

Sincerely,
Dr Gerald Kenning

Of all the things the doctor explained, I loved him for his final words the most.

_________________

Dearest Edward, my diary and confessor, wonderfully patient lover of my befuddled mind,

I met a wonderful man today! Well, perhaps "met" is the incorrect verb... I received a recorded greeting from a wonderful man today... and he certainly wrote to me the night before, but it feels so much more real now that I've seen his face! I'm afraid its quite impossible for me to meet anyone under normal circumstances with this infamous "condition" preventing me to socialize with people during normal meeting hours! But I'm quite distracted now. I met my doctor, and he is an Elder! I don't believe I've ever seen one in real life, let alone been given the privilege of being in correspondence with one.

Its only the second Night since coming to the State Hospital, and I'm ever so bored and lonely most of the time. I never wanted to be alone. You can argue as much as you like, what with my isolating eccentricities and all, but I never asked to be the only one awake at night. The workers here try to provide items to keep me busy... fruit to eat and ever-so many books. They left me some paper and pencils tonight. Gerald even said I could write him if I wanted! Did I fail to mention the doctor's name is Gerald? Quite folksy for a name, with a slight debonair... Look at me, all ablush and giddy towards my own doctor! I suppose it can't be helped... I haven't even met another man for months, even if he was previously recorded. He said that he would record something for me every now and thing to keep my spirits high; he may even be able to get recording from my family. I would be terribly grateful to him if he could, even if he weren't charming...

I've decided to ask him for a game. When I was home, father would sometimes try to teach me to play chess. I was always far too ebullient to sit and play an entire game, but now that I find I have little to entertain me, I miss the puzzle a good game of chess presents. It would be easy enough to play, but the matches would be quite extended in length. I would only be able to make one move a night, seeing as how my opponent would be asleep somewhere else, dreaming the Night away. But, that would give me the chance to relearn at my own pace and I think I would feel like someone were paying some attention to me beyond all this hospital business, even if it were just to move some small pawn...

And not to be offensive, Edward, but I find the attention of a diary somewhat lacking. You are a fantastic listener, but an awful companion when it comes to the art of conversation.

__________________

The Strange Case of the Girl and the Gods

2010-09-18T21:11:00.003-04:00

These transcripts are from the recordings of doctor Eldrich Mendelson, Universal Psychologist to the Planets, 2nd degree, and Servant of the Ordered Worlds. The following interviews take place between Hanon 13th, 903 and Planer 37th, 905 at the Universe Asylum. The case subject is named Tiana. The initial recording is for an introduction to the facility and provides context for the environment in which Tiana was placed. I hope the information help in your investigation, Commander.

___________________

(static) ... should be... without... there. We should be running now. Thank you for waiting.

Not at all, doctor. You do us all a great service by helping us. Should we proceed with the tour?

Please, by all means.

(footsteps)

This is the mess hall. Some of our calmer residents can freely come and go and eat whatever they like. Others we feed in their rooms. And others still we keep sedated and feed intravenously until there is a time which they can be cured or studied safely.

How many residents are there?

To be honest, doctor, I do not know, and that is by design. The Asylum covers the entire planet, and our patients range from your normal schizophrenics to the truly insane. He also have special residents from other dimensions and time-warpers that had unfortunate accidents. Left bits of their brains in the past or future. The facility is designed to house any and all persons and individuals that may be less than civil and more to the point, uncontrollable and dangerous. Needless to say, our security methods are substantial and thus all the secrecy to the workings of the Asylum, even among administrators.

But how can the Asylum run if there isn't someone who knows everything about it? Someone in charge?

That's part of the beauty of it, doctor. With no one in charge, there's no one to revolt against. No one knows every schematic or door code. So if there people who work here don't know how to escape, how would the residents? This way, please.

(door opening)

We are entering the private wing. The are patients here are residents of their own free will, as well as some who do not have an underlying malady contributing to their... instability. Your client lives here. She's been significantly isolated.

I'm still not sure what exactly I have been called in for.

There we have something in common. My orders were simply to take you to Tiana, wake her up, and ask that you help her.

Tiana? Is that the name of the patient?

Well, to be fair we don't know her real name. We're not even sure she has one. We heard a distress call from one of the outer planets. When we arrived, there was no one to contact. We picked up a single life form, and there she was. Once we found her, we sedated her and brought her on board. The name Tiana comes from us, the guards and technicians who brought her here. Do you know what it means?

Its origin is old Riddian, isn't it? I seem to recall that Tiana was the name of the goddess of passion...

You know your mythology well! Ah, here she is.

(silence)

Her? She looks so young! She can't be more than fifteen!

Fourteen, we guess, unless she ages differently, though we haven't noticed anything unusual yet.

What have you noticed about her?

Not much, I'm afraid. We've kept her sedated since we found her, so he have yet to witness her speak or even move.

You've kept her sedated? For how long?

Almost three years.

Three years!? What is wrong with you? She's just a child!

(laugh) While your sympathy is noble, dear doctor, it was no place with this one. When we found her on that outer planet, she was alone. A single life form, remember?

Alone? I'm not sure I understand your meaning.

She was the only living thing on the entire planet.

The whole planet was empty?

I never said empty. It was once a thriving colony. Still young, but there were cities, spaceports, harbors. Civilization. We have documented that the population was somewhere around 1.7 million people. And that's what we found. 1.7 million bodies. She killed them. She killed an entire planet, doctor. And I don't mean with bombs or guns or anything. She used her wits and her bare hands. We have no idea how, but the bodies... we collected hundreds of them, performed autopsies and investigations. Each one was killed by someone's hands. I wouldn't have believed it if I hadn't seen her kill with my own eyes. When we found her, she was just sitting there, dead bodies all around her, bloodier than you can imagine. I sent a team down to collect her. When I didn't hear from them, I sent a second. Then a third. I sent almost an entire platoon of men with the most advanced weaponry the galaxy has ever seen to collect that little girl. She killed them just as easily as the rest of that planet. She tore through power armor like it was made of paper. I have no idea how its possible, but that little girl can dodge bullets, survive explosives, emerge from aerial bombardment without a single scratch... there was nothing we could do to collect her, until I tried simply asking her.

You... asked her?

I asked her. Sent down a comm unit, and asked her to sit on the ground peacefully. She did. I then told her we were taking her away, and she nodded. She willingly took the first sedative that put her under, and now she's here. I can't make any heads or tails out of it. This little girl slaughters a planet of millions people, and she just sits and takes instructions like a child.

She is a child.

(pause)

So she is. But its that idea of talking that has the government all excited. That's what you're here for. I've been ordered to wake her up and let some Universe Psychologist talk to her. Try to get her to work for us. But I have to be careful, and take the safety of the rest of the Asylum into consideration. You realize the position this puts me in, doctor. I have the government breathing down my neck, but I'm not going to sacrifice another one of my men to that monster.

With all due respect, sir, I wish our positions were reversed.

(laughs) I suppose you have me there. We will wake her tomorrow morning, and you will be sealed in a containment facility with her when we do. You'll be miles and miles away from another living thing, but we'll have recording equipment and a comm if you need to contact us for anything. If things go awry, you'll be the only one she kills. Hopefully. But who knows? She hasn't spoke to anyone for years, maybe she'll enjoy a little conversation.

I certainly hope so. Any chances I can turn down this job?

I was ordered to have my men kill you if you did. (footsteps) By the way doctor, you forgot about one thing.

And what is that?

Tiana was also the goddess of death.

(end recording)

_________________

*static* ...Testing... Testing... This is Doctor Eldrich Mendelson, Universal Psychologist, and this is the first session with subject after awakening. Hello, my name is Dr. Mendelson. And what is your name?

...Name? What is a name?

What do people call you?

Call me? I don't understand...

When people are born they are given names. A word or sound that is different from other words that can be used to identify them as separate from other people. Parents usually give them to children when they are born. When you hear your name, it means someone is trying to get your attention. It is something that lets other people know who you are. Do you know of anything that may be like a name for you?

Perhaps... perhaps what my parents called me first? Perhaps what people say when they see me?

Yes, that could be right.

(Loud screaming ensues for several seconds)

Oh god... open the door! Shut this down! Let me out of here!

(A door opens and closes. Screaming can still be heard, though muffled.)

This was a mistake... (heavy breathing) Subject has limited social understanding, and appears to have psycopathic tendencies. The door is locked, and she finally stopped screaming... my god, does she believe those screams are her name?

(end recording)

___________________

To be continued...

Untitled

2010-09-16T21:20:00.001-04:00

The darkness was everywhere. I think I was somewhere in-between, not quite asleep but not quite awake. Not matter how hard I tried, I couldn't pry open her eyes. I had thoughts and images in my mind, as if conscious, but nothing could be seen.

"Is she going to be alright, doctor?" I heard mother.

All I could hear were voices. Muffled voices, like through a thin wall, or through water. When they spoke, the darkness dissipated a bit. I still couldn't see, but its as if the sounds summoned lights from behind a veil. Muffled, like the voices, but I could not deny the light was there.

"Its hard to say. I've never seen anything like this before. It doesn't seem to be doing her any harm, aside from a social or psychological impact. In fact, she may even be physically better because of her condition. I have hundreds of people tell me they don't feel like they get enough sleep before the Dawn, and they yearn for the ability to just get an extra twenty."

"But I'm worried about her. I've never heard of such a... condition."

"That's because there hasn't ever been a documented case of someone sleeping beyond the Dawn for over three hundred years. Before the bombs fell." his tone was scientific and cold, but after a few moments of silence it changed, "I know you're worried. You're supposed to be. You're her parents and you love her. I don't see any reason why she cannot stay at home over the next few months. If her sleep state progresses further, say, into the early morning by a few more hours, let us know. We may be able to take her to the State Hospital for observation where she will be safe, especially at Night."

"Thank you doctor. Just the idea of her being awake while the rest of us sleep... all alone. I simply cannot bear it."

"You will not have to bear it alone, if it comes to that. The State Hospital has some cameras that can serve as our eyes at Night. We'd be able to see everything she does, even communicate a bit with her, if need be. Just do all you can to make sure she stays in high spirits. It would be a shame to see such a lovely young girl fall into a depressive loneliness."

"I will. Thank you doctor."

The voices went silent, and the darkness returned. I wished I could just fall asleep.
____________________________________

Dearest Diary, sole companion in these woeful times, nonspeaking hearer, loving spy, and unabashed pauper of flimsy cheap paper,

Greetings! This is my first entry, and it is only customary that introductions are in order. My name is Caraline Theanin of the family Farmour Theanin, and you are my diary. Most people just call me the simplified Cara. I do not have a name for you, for I am told it is not appropriate to give names to books, but seeing as how I have no one else to talk to, I imagine it wouldn't be beyond my scruples to at least imagine you were slightly more human than you are. Because I am very much alone, and I grow more so each passing Dawn.

You were a gift from my mother, a loving woman but quite a doter. She fears that I am slipping into a sort of "depressive loneliness" because of my "condition." I suppose I should take a moment to explain. You see, I sleep longer than most. Or perhaps I am awake longer... I don't really know which it is. In any case, I am awake while all others on this planet sleep through the Night. It was only for a few minutes at first. I still remember when I was a young girl thinking something was wrong with me. I would get very hungry lying in bed, knowing I was supposed to be asleep, and I would get up to fetch some bread, only to have the Sleep come onto me right there in the kitchen. Father had a fit thinking I had choked and died right there the following Dawn, when everyone awoke and I did not. At least, not right away. I woke up that morning to some bread in my mouth and six faces with the most horrid looks staring down at me. That is not a proper way to start a day!

But now I stay awake through the Night for hours. I imagine I sleep through half the day now, and I'm awake for half the night. It was all very annoying initially, but this chance ability has turned me into quite the celebrity in hospitals and State governments. Everyone wants to know: how does little Cara stay awake?

I would rather be known for some stroke of genius, or perhaps as a beloved author, but alas! My fame is as an oddity. I've been to the doctor countless times, both asleep and awake. I remember very little of those encounters, though. I've even been told I've been seen by one of the Elder physicians! I only wish it was for something where I had a little more control, not a strange happenstance of fate, a malady, but rather my beauty, or perhaps my wonderful wit.

Do not let my charming humor deceive you. I'm really quite scared. Tomorrow... everything changes. I have to go to live at the State Hospital, where lots and lots of doctors with lots and lots of stethoscopes and needles can watch me to their heart's content, trying to figure out what's wrong with me. Why I sleep so differently, and I imagine to interview me. Asking me questions about the Night and all. Because apparently, there's been no human being who has ever seen what the Night is like since the bombs fell, save for a very few Elders. But I don't want to answer any questions. I don't want to live in a room and never leave, eternally watched and studied by old devices and old doctors. Why can't I just be Cara, the strange girl who sleep oddly, but never hurts anyone otherwise?

But you, dear diary, were a birthday present, something to prepare me for the move and transition to the solitary life. I have been encouraged, now that I am the mature age of fourteen, to start writing and reading more, while exploring and rabble-rousing less. While I do enjoy a good story, nothing quite compares to going out and making your own adventure, or so I say. But, I am told by "those wiser than you" as father would put it that if I were meant to live adventures, then the adventures would find me, and it was foolish for me to look for them "before they were ready for the storm that is Caraline."

Father may be right. Even now, I'm at the doorstep of a grand new adventure, traveling to unknown places to make fantastic new discoveries about myself, and all I'm doing is shaking in my boots and pouring my feelings onto a few morsels of paper.

Perhaps that is enough for one day. I have yet to say my goodbyes before everyone Sleeps, and when I wake I will be somewhere unfamiliar. I imagine we may spend a significant more time together, dear diary, as I have already been promised sufficient paper and writing materials for my stay at the Hospital. It was a pleasure to meet you, and here is good fortune to our next meeting!

And I have decided to call you Edward. I hope you like it.

The British Library

2010-09-14T21:47:00.003-04:00

Got pretty inspired during the pipe-smoke tonight. The book plot it getting altogether in my head still, but I like where its heading! And these are by no means finished entries of the book... they need more language to direct the reader's imagination, methinks, but it's good to get some things down in written form

Owner Malcolm lead Inspector Thyme and Sebastian to a large limousine parked outside the offices of the Animal Yard. A crowd was gathering near the steps when though it was pouring a dreary. The Owners so rarely make an appearance in the Animal Districts that it always sparks a lot of rumors and gossip, especially among the mouse and bird folk. Thyme pulled his overcoat tight around his shoulders and quickly ducked into the cab. Sebastian followed and Owner Malcolm sat across from them in an opposite facing seat. He was joined by a female Owner, one strikingly beautiful, if a creature could be trusted with such a judgment.

"I'm sorry, Inspector, but I must ask you and your associate to put these on." Malcolm handed them a pair of blindfolds. "Both for our safety and yours."

"I would like to know where you are taking us." said Thyme, as he reached for the blindfold.

"We are taking you to the British Library, to the Offices of Human Affairs." Thyme paused, and Sebastian shot him a quick glance. "Don't worry, we aren't taking you there to bury you." he laughed, "We have some business to discuss."

"What sort of business?"

"We will not talk of it until we arrive." the woman answered. She was stern and cold.

Thyme and Sebastian put on their blindfolds. As the traveled, Sebastian kept his mind busy attempting to count the number of turns and cobblestone bridges they crossed over. Thyme had enough on his mind contemplating what all this business was about. The British Library was where the Owners kept all their government offices, as well as their secret museum of artifacts and ancient technology. Not many of the creature world knew what was stored there. While all of it still lay dormant, the devices in the Library provided much of the genius behind the Owner's Steam Revolution, and after the machines were disassembled and relinquished they're ancient knowledge, they were meticulously reassembled as used as trophies. They served as a testament to their resourcefulness and intellect, the Owners told themselves, but more truthfully, it was ill-gotten knowledge taken from a time that was not theirs. They were no more than thieves, grave-robbers of culture and history.

The car quickly came to a stop and the two felines were escorted out into the rain. The thunder claps echoed around them, giving evidence to the surrounding buildings and their massive size. The steps toward the library were too large to be taken quickly by the animals, even if they were not blindfolded, and Thyme stumbled more than once on the stone.

Once they entered the Library, their blindfolds were removed. As their pupils adjusted to the sudden light, Thyme and Sebastian stared in wonder and what lay before them. They were in a large rotunda, bigger than any room they had ever seen before. Around them were glass cases filled with tools, manuscripts, maps, and other devices too foreign to classify. Next to the cases were large platforms and upon them sat vehicles of ancient technology. Some looked to be farming equipment, or transportation vessels, but Thyme had seen too much in the last three days to make any judgments as to what they could be. And that's when he became afraid. He remembered the dig and what he and the mole had found there. Of course! The cog! All this business could be about that infernal gear! But how could the Owners know? Surely that was the reason for the dig ordered by the Owners, to find the cog, but no one knew about their findings save himself and the mole. He didn't even tell Sebastian. Could the mole have been loose with his tongue? Or perhaps they were followed that night?

"Come along. You'll have some other time to see our wonders." Malcolm said. He spoke as if he made the devices himself. He lead them quickly down a hallway to the right, past large doors with enigmatic words painted on them like "Dept of Hidden Journeys" and "Offices of Forgotten Prophecies." Sebastian was bold enough to make the observation vocal, "What strange names for organizations... 'Dept of Magnificent Poems and Dangerous Songs?' What is this place?"

"True, some do find them strange." Malcolm responded, "But if they were names good enough for the Ancient Ones, they're good enough for the Owners. Perfectly suited, I think. These are names taken directly from the governmental texts that we past earlier. Their meaning may be a bit different for us than it was for them, but we are trying to rebuild that great society in every way we can. And maybe along the way, we can make some adjustments of our own. Avoiding past mistakes and all that... Here we are."

The hallway opened to a great cavern of a room. If they were not indoors and so well lit, Thyme would have thought they were inside the very mountains themselves. A large wooden banner hung overhead that read, "Offices of Human Affairs." The room was more ornate that the proper title it held. All around were great lighting apparatuses, ornamental vases and couches, pools of water and great steam vents. But in the center of the room was a piece that claimed all the attention.

"What.. is that?" Sebastian exclaimed. Even Thyme could not help but gasp at the sight. In the center of the room, a giant creature stood, made of metal, copper, and brass. It was shaped like a giant wolf, but had the face of a man. Its size was mammoth, larger than many homes put together. It shone with a particular brilliance in that light, and its head was tilted toward the entrance to the room, either to greet or intimidate any that pass by.

"That... is the Whordgen of London." answered the female Owner

"Whord...gen? What is a Whordgen?" asked Sebastian.

"We aren't exactly sure ourselves. We haven't yet found any texts that refer to it, but the name in emblazoned on the shoulder." True to fact, the letters were stamped clearly across a large brass plate covering the shoulder joint. "It is the largest discovery of ancient technology we've ever made. We've been unable to determine what it does; we can't even disassemble it. But we're experimenting with some new wave methods that may allow us to peer inside without opening it. But that doesn't concern you." Malcolm said, as if coming to his indignant senses. "This way."

They were lead into a small room with the word "Owner Officers Malcolm and Cylith, Animal/Human Relations." Thyme guessed the female Owner must have been Cylith. There were two large desks littered with papers and files, and the were surrounded by bookshelves. Two small chairs faced the desks, and Thyme and Sebastian were directed to sit in them.

"We have much to discuss, Inspector." began Malcolm as he took his place behind his desk, "There your investigation into the animal murders and this nasty business of the human homicide. What have you found so far?"

"I'm afraid not much. It appears that a sickness has begun spreading amongst the lower classes of animals. I'm not convinced these killings are murder, though. In each victim, the wounds are self-inflicted."

"These are suicides?" asked the woman.

"By appearances, yes. And I've come to believe that we are meant to think they are suicides. But there is too much order in their frequency and nature for them to be unrelated." Thyme paused. He weighed in his mind how much he should reveal, and how much the Owners may already know. The warning of the priest hound echoed in his head, "I believe the Owners may be the cause of this..."

Thyme resumed, "But I can see no motive apart from inciting fear and panic among the populace. There are too few clues to give clear direction to the investigation, but I theorize there may be more than one culprit behind the crime."

"No matter." interrupted Malcolm. "The affairs of the animals are not our chief concern. What does concern us is the murder of the human at the hands of an animal."

"That was an isolated incident, and the creature responsible has already died. His wounds were grievous enough when we found him." explained Thyme.

"Was he interrogated?" asked Cylith.

"He never regained consciousness. Evidence points to some kind of brawl. Perhaps the dog was defending himself."

"Defending himself!?" exclaimed Malcolm, "Need I remind you that animals are the violent creatures in the world, and not humans? A man would never attack a dog without just cause."

"With all due respect, Owner" replied Thyme, "Experience tells me otherwise." A heavy silence pressed the room. It seemed to make Thyme's facial scar more pronounced. Malcolm coughed.

"Be that as it may, since there was a human victim it is a human investigation. Your initial scene investigation will be taken into consideration as a consultative opinion. Is there anything else we should know?"

"No, Owners, there is not."

"Very well. That is all."

Thyme and Sebastian rose to leave. As they approached the door, Malcolm spoke.

"Wait a moment, Inspector. There's one more thing to discuss. We know what you found at the dig three days ago."

Thyme froze.

"What is he talking about , Thyme?" asked Sebastian.

A smile appeared on Malcolm's lips. "You mean he didn't tell you? It seems the Inspector doesn't trust his own kind." the Owner quipped. "Please return to your seats."

Thyme turned and sat down. Sebastian eyed the Inspector a moment and then moved to his seat.

"Did you really think we would miss a crater more than a mile wide in the chasm wall?" Thyme's claws extended instinctively. He began thinking quickly, creating a story that could be both innocent and keep the discovery of the cog hidden. Malcolm spoke before he had a chance to respond, "And don't bother making any excuses. The mole told us everything. It took a bit of interrogating, but not too much. He weaved a story about explosives gone awry that had more holes in it than... well, more than you made with that weapon's fire."

"I don't know what you're talking about." Thyme said.

"Yes you do. You've learned more than we would have liked, but I think I can use this to our advantage. Owner Cylith here would just have you sent to the cages no question, but I come from a more merciful and understanding stock. I surmise that you found yourself an eternal cog, am I right? A gear that magically turns on its own, and doesn't stop turning?"

Thyme said nothing.

"We're not idiots, Inspector Thyme. You may think that cog is what we were looking for, and he had a suspicion one was there, but its only a minor cog. What we're really looking for is one that can bring the Whordgen back to life, and that little thing can barely power a gun. What you witnessed was only a small part of the power of ancient technology. We guess that the vehicle found at the dig and the many like it were piloted by animals like yourself in the great war between humans and creatures. And history shows that the animals lost." Malcolm relished

"Animals... always so quick to hunt and kill. It's any wonder that your kind has survived this long. Always fighting against each other... Why if it weren't for the reasonable and forgiving nature of humans, you would have all been dead long ago. The Great War was started by the animals, that much is certain, but the Ancient Ones won, and we humans are their rightful heirs to their power. But that's no matter. I've decided you can keep your little cog. We have plenty like it already. We have no use for it, but you we can't have you powering any weapons with it. We will confiscate any devices and machine discovered at the dig, but we can't well erase your memory of your little discover. But since you know a bit more about how the old technology works, I've decided to send you on a kind of mission."

"What kind of mission?"

"We want you to find another cog. This time, a bigger one, one that can power the Whordgen. We think there might be one south of here, across the channel in the mainland. The empire of the Ancient Ones was vast and it stretched all across the globe. We have reports that there is a new find in the region of Old Germany that looks promising. It appears to have been the location of a major ancient city, perhaps even a sort of capital. Its a veritable treasure trove of manuscripts and devices, but it hasn't been fully explored due to some... inconveniences."

"What sort of inconveniences?" asked Thyme, cooly.

"We don't know. We haven't received word from our dig teams there for months. We are sending you there to investigate."

"I'm afraid I must refuse. My investigation here into the animals murders requires my full attention."

"That investigation is no longer under your care. You are hereby relieved of your duties as Inspector of Animal Yard in London."

Sebastian exploded, "You can't do that!"

"Of course I can." smiled Malcolm, "You knowingly withheld knowledge of a significant find from a dig propagated by the Owner's, fired illegal weaponry within Owner territory, and stole an ancient artifact that rightfully belonged to the Owner State. You should be buried, by any interpretation of the law."

"By your law, you mean" Sebastian interrupted.

"Our law is the law, animal." Malcolm's eyes narrowed on Sebastian "And you would do well to remember it."

"Let us put it to you another way:" answered Cylith, "either you take this opportunity and do what we say, or we throw you and all your accomplices into cages until your execution can be scheduled."

"It appears that I have no choice."

"Come now, we are no tyrants." Malcolm replied. "You always have a choice, dear feline. Just some choices are more agreeable than others."

"Very well. I'll take your mission. But I need a team to come with me. There is no way I perform this duty alone."

"Agreed. You will take your secretary, and your mole friend as well. He hope that the team of diggers is still present at the site, but we will send extra supplies with you."

"How will I get there?"

"There will be a skyship waiting for you in a week's time. It's not a luxurious vessel, merely a supply transport, but it's crewed by other animals so you should be at home. And while you are away do not plan anything... risky. We will know, and will have special arrangements for you and your friends should anything unexpected occur during the investigation."

"Owner Malcolm, I have agreed to do as you ask. I do not betray my word, unlike some of other kind I know."

Malcolm stared at Thyme hard. He wasn't pleased with the tone the feline took, but he knew that Thyme was reliable. "Then it is decided. Make your arrangements at your office. You will be replaced and leave within a week. You are dismissed. An escort is waiting for you to return you to your homes."

They rose to leave. On the way out, Sebastian paused and turned to face the Owners. "I just have one question," he asked "what's so important about this Whordgen? You said yourself you don't even know what it does. Why do you want to turn it on?"

"Because it was made by the Ancient Ones." said Malcolm, "Its function must be to help humanity in some way. Some say it could be a weapon. Some say it could be a vehicle of salvation. Either way, it was made by humans to serve humans, and we intend to master it."

Thyme and Sebastian left heavy. Sebastian said little to Thyme on the way out of the Library. He was undoubtedly hurt by Thyme's omission of the incident at the dig. Thyme was enraged at the gall of the Owners toying with his life and those of his friends, but he feared he may have damaged his friendship with Sebastian most. In any case, they would be leaving on an unwanted journey within a week on a vessel they knew nothing about. The Owners were known to have exotic forms of travel, and there were rumors of a ship that could fly through the sky, but he had never heard of any excursions onto the mainland of Europe. That land was forbidden to the animals, and rarely spoken of by the Owners. They would talk of a fallen and barren land ripped apart by the Great War; there was nothing there that made it worth inhabiting. But it seems the Owners took a new interest when they found this great city, and Thyme and Sebastian would soon find out for themselves what was awaiting them.

The Choice

2010-09-12T22:50:00.001-04:00

When you die, the makers of this world present you with a compelling opportunity. You have the option to live a second live on this planet with all the knowledge, memories, and lessons learned from your previous life. Every hurt you ever experienced, every partner you ever dated, every investment you ever had comes with you again. When you're born into this second life you are just as aware of yourself when your last one ended. You get another life to accomplish all the things you didn't finish before, but there's one caveat. When you die in this second life, you are gone for good. No eternity, no heaven or hell for your soul, no great slumber. That's the end.

You're given as much time to consider the proposal as you need. During this time, you're placed in a sort of waiting room. Its the closest thing to Purgatory you can think of; the walls are large and white and there are chairs everywhere to contemplate your decision. There are others who have died and are in the process of thinking. Some people chat in groups about the pros and cons of such an offer, while others sulk in the corners too fearful to come to any kind of decision. As it turns out, you don't need much time to decide. You enjoyed your life on earth, and the idea of an eternity away from everything that planet has to offer isn't very compelling. You decide to go back and live this second life.

In the midst of preparations for your departure, you make small-talk with one of the afterlife engineers. You discover that you are only one of a very select few who have decided to go back. He begins naming some of those who have gone before you, and it is indeed and illustrious group: Buddha, Jesus, Einstein, Mother Theresa... but then some names give you pause. Hitler, Genghis Khan, and Hussein. Undoubtedly, every man and woman he mentions belong to a group of people that had significant influence and changed the course of human history, either good or ill. The engineer quips that our memories can be powerful tools of good or evil, but in the end each of these famous persons just ceased to be. They chose to give up eternity in order to shape the course of humanity. Just as you began to lose consciousness and re-enter life on earth, you consider what kind of choices you'll make to live this second life or yours.

You are born again, and the world considers you a natural genius. You blaze through grade school, but you now find history somewhat boring. You graduate top of your class in high school five years early. It seems that colleges and universities the world over can't help themselves but give you honorary doctorates and degrees. You discover new ways to grow food in the harshest climates, create technology that renders the weapons of war inert, and use great political savvy to promote peace and prosperity the world over. For the first time in the existence of the human race, there is no war, no famine, no cause for want. The people greatly admire and love you, you become a common face on all the popular news stations. You teach people how to live with their differences and overcome conflicts constructively. You begin to sow the seeds of a world without hate or malice, but there is always the nagging question in the back of your mind, "What did I sacrifice for this?"

You begin to suspect that, deep down, the world may not be perfect as you have crafted it. You know that one day when you die, this world will continue but your eternal afterlife is forfeit. What's to keep someone else from choosing a second life and changing everything you've created?

You begin to obsess with the idea of death. You surmise that if you cannot create a world that could be perfect forever, then you will find a way to cheat death and keep the world the way it is. You spends enormous amounts of wealth on institutions and research organizations designed to combat disease and decay. You fund large scale projects to extend human life spans and maintain brain activity. You even create new religions that spur the movement of "immorology" and inspire men and women to pursue eternal bodily lives on their own. Soon, you achieve the impossible and immortality becomes a reality.

Initially, the world erupts in celebration of your genius. Truly, history has never seen human achievement the likes of you and your work. You become the most famous person to ever live and your immortal life is good for a while. But soon, people become bored and lazy. Since there is no longer any death, there's no reason to rush things. This lack of energy soon breeds a decline in progress. People are more and more late for work. Students skip class. People marry and divorce more quickly. Since no one ever dies, why go through all the work of doing things?

Spaceships stop launching. Economies crumble. Houses are left unfinished. You begin to learn that selfishness comes hand in hand with immortality, but its too late the change back. People start to become more and more pessimistic. Meaning to life vanishes and with it, the will to continue living. Once humanity gained mastery over every aspect of life, motivation evaporated. There was no longer any else worth discovering. Suicides skyrockets. Fights began to break out again. As it turned out once humanity began to live forever, the only thing left to do was die.

You watched in horror as the perfect world you made crumbled into chaos. Wars erupted amongst nations and families that never had any qualms with each other; they just wanted to die. People begin to blame you for the way the world turned, and your second life ends as a mob crashed through your home.

You awaken to the makers of the world, and they shake their heads. You realize you're already strapped to the machine that will destroy your eternal soul. You see the engineer out of the corner of your eye, and you can't help but ask him where you went wrong. He laughs sarcastically, and simply says that all humans are the same. No one wants to die, but no one wants to live forever, either. Heaven and hell are filled with people who will always wonder what it would have been like to go back and live a second time, while earth is filled with people who will always wonder what happens after we die. The choice of the makers is an act of mercy. To be smashed from all existence is the only way to end the cycle. With that, the engineer flips a switch, and you are gone.

On Rain Readers

2010-09-11T22:52:00.002-04:00

In each age of history, there are certain roles that the creatures of the world adopt. Some work the soil to provide food for others. Some build shelter and structures to use as homes. One distinct role that has survived the eons and cultures of the world, and serves to be a radical curiosity from my secular perspective, is that of the spiritualist. I define a spiritualist as someone set aside, someone chosen not necessarily by a god or a divine creature as they would have you believe but more by their community to act as a liaison and mediator to whatever deity a culture chooses to believe in. Many times these spiritualists serve two functions, to relay a message to god, thus serving the organizational needs of the society as well as act as a community healer, such as the aboriginal witch doctors or shamans. Some served as a moral standard, like the prophets of old, and dictated the actions a community would need to accomplish in order to restore balance. Others still would serve as agents of social change, acting with a divine authority to achieve some illustrious end or bring warring tribes to peace. In this present age, we do not have the likes of shamans, prophets, or revolutionaries. The progress of technology and science has created more wonders than any god ever could. But there are still some of lesser minds who hold to the old ways while still reaping the benefit that science bestows. Many of the Norther Raven flock have been remarkably resistant to any societal change. While others of their feathered kind have adopted careers as mail carriers or transportation specialists, the Northern crows mainly keep to themselves. Most are adverse to fraternizing with these kind, but my lot as an investigator drives my curiosity to research these paradoxical creatures. I have learned that while they do have some modern means; steam wells for clean waters and irrigation, for example, they still maintain an important place for their spirituality within their communities. I have witnessed recently a ritual for deciding their own unique role of spiritualist, one among them whom they "set aside." Such a creature is given the title of Rain Reader.

Of the tribes in the North, each one has a Rain Reader who, once selected, abandons the tribe to live amongst the other Readers. This is because of the widely-held belief that their knowledge and skill is pure, and living amongst the common crows would sully their wisdom and abilities. I have never affiliated myself with the Rain Readers much, nor they with the rest of the world. They are an enigmatic and small group, keeping to themselves and teaching their ways only to their offspring. The closest thing I have been able to compare them to historically have been the Oracles of humanity's Rome, but even they lack the proper description. The Rain Reader's purpose, as they themselves dictate, is to make "certain truths known." A very clever phrase, as they can claim whatever truth they do reveal as incomplete, which then serves to free them of any subsequent responsibility of action. Each year, the Northern Raven tribes convene for several days of festivals and prophecy. It is at these gatherings that tribal laws are established and modified, new Readers are selected, and marraiges and other social contracts are codified. The occasion is called the Storming, a reference to the abundance of dark feathers and loud caws that accompanies such a large number of ravens.

I have only met two Rain Readers in my lifetime, before meeting the captain of the skyship. The first occasion was when I was a small kitten, and I walked the streets of London delivering the daily news. On one particularly dreary day the rains were hard, so hard that one could see only a few yards before them. I sought refuge in a great stone archway across the street from Trafalgar Square. I peered across the downpour to see a figure of a crow in the middle of the square, which was an odd sight to me. The birds always knew when the rains were coming before we land folk, so they would normally abandon the area for clearer climes. But this bird was just sitting in it staring upward at nothing, as if in deep meditation, or something above was speaking. He slowly spread his wings in that rain, and then let out such a crow as I had never heard. It was loud, piercing, not a cry of help or a scream from a deathblow, but not unlike them either. Then, he lowered his great span, and turned directly at me, and stared into my very mind. I am unsure how long I stared back, but before I realized it the rain had stopped, and I turned a moment to reclaim my bearings. When I once again looked to the Square, the Rain Reader was gone.

The second encounter occurred some time later, after I had been promoted to Inspector at the Creature Yard. It was the same Rain Reader, I could tell. He had been murdered, and his body lay in Trafalgar Square. Poor bird had been killed sometime in the night during the storm. His wings were spread as they once were so many years ago. His head was to one side, beak slightly open, eyes wide, and they still gazed into my mind as easily as before. We had never found the killer; we didn't even have a motive.

Now, upon the great ship in the sky, I saw the second Rain Reader I had ever come across. It sat before a small porthole on the starboard side, decrypting the raindrops as the fell and pattered with randomness upon the glass. I was once told that the Rain Readers believed those raindrops were not random, but messages from some god or divine creature. That each line, speck, and patter of water was trying to tell us something, but most creatures had forgotten how to listen. Frankly, the rain does have a sort of romantic beauty as it trickles down on clear faces of glass, but I consider that to be subject for the poets and muses, not any oracles or prophets. But, mythology tells us that the mundane and often overlooked aspects of life were the preferred mediums of divine communications. I had never encountered any god in tea leaves or raindrops, but it is a way of life that was worked for these ravens for thousands of years, and who was I to judge such matters?

Besides, my chief question was not about the rain was trying to tell us, but why a Rain Reader from the Northern lands was on the skyship at all.

The Eternal Cog

2010-09-09T18:21:00.002-04:00

They descended down into the chasm. The daylight was growing dark, but as they went the light faded around them. The air was heavier there, and soft layer of dust and dirt filled the space around them. It wasn't difficult to breathe but it was pungent with the aroma of old earth and secrecy. The ground was hard and the distant hums of power throbbed about them.

"What have you found?" the Inspector asked.

"We're not sure." replied the mole "It's something I haven't seen before. There's a bit of ancient technology in these digs, but I've never seen anything like this." As he went, Thyme could feel the mole's excitement. Something ancient had definitely been uncovered, but finding the machines of old was commonplace and ultimately futile. They were grand machines but there was nothing to do for them. No one ever knew what they were, what they did, or how they were even powered. All the completed machines were so large and laborious that even the Owners couldn't turn them on. They required too much energy, far more than any steam technology could provide in modern day.

"We were getting some unusual waves from the rock beneath." the mole continued "Something very small. It seemed to be... moving."

"Moving? Is it something alive, or is it a machine that is still functioning?"

"I don't think so, it's too small for that. Here." They arrived at a small clearing that was freshly dug. It was faintly lit, but that's how the moles preferred to dig. "I wanted to wait until you arrived to uncover it. Something tells me that I would need witnesses and possibly protection."

"Protection?" started the Inspector "Protection from what? You said yourself there was nothing living here. Besides, there no sense in being so clandestine about all of this."

"Forgive me, Inspector, but experience has taught me otherwise. Just wait a moment and be on guard. I'm going to start digging." And with that, the mole went to single-minded work. His energy could be felt, and Thyme instinctively moved his paw to his revolver. After a few moments and a flurry of debris, the mole stepped back and gave a sigh of relief, "There. There it is."

In the ground, halfway uncovered from soot and earth, was a gear. It was of a size no greater than a large fist and it was ordinary in every respect except for one distinguishing characteristic. It glowed a deep, pale green.

"My eyes may be adjusting through the fog but is that cog... turning?"

Indeed it was. Very slowly, the gear was turning counter-clockwise. "But... what mechanism is it connected to?" asked the Inspector.

"None. There is no other machine or metallic signals for several feet. That cog is turning on it own."

"But how is this possible?"

"I don't know. I've never seen this before. Its a perfect gear, apart from being in dire need of cleaning. The teeth show no sign of wear and it appears to have and ancient but common mounting mechanism." The mole slowly lifted the gear from the ground and held it both hands. "You see, it still even turns in the free air."

The two stared in amazement as the cog slowly moved in the paws of the mole, stopping to no resistance and seeming to have no cause to its motion.

"I've heard about the machines of the Old Ones needing a seemingly limitless supply of energy and mechanics in order to function." began the Inspector. "Do you think this might be the source of their power?"

"There is a simple way to find out. Come with me" With that, the mole journeyed further along the rubble and debris. They soon came to an ancient machine, what looked to be a vehicle or moving Juggernaut. It was large, taller than both the Inspector and mole together but it was silent, unmoved for centuries.

"Climb the ladder on the other side. You will find a seat with a panel of levers and buttons. We uncovered this machine several weeks past. Its a common design, but we have no clue as to its use. Just last month another squad of moles discovered hundreds of these machines in a field just a few miles north of here."

As Thyme moved the mole continued talking. "The outer shell is easy enough to remove, but underneath is a marvel of engineering so complex we can't make heads or tails of it. Most are damaged in one way or another..." Thyme moved to the seat while the mole removed a part of the case "... but this one appeared to be in good shape, as far as I could tell. Now, where was that spoke... ah! Here..." The mole placed the green gear into the machine. "Has anything changed?"

"I'm afraid not." As the gear began to turn, Thyme could hear the creaks and cracks of old technology giving way to the new addition but after some moments the machine was silent.

"Well, it appears as though the gear fits, but nothing is happening. Perhaps it would work in some other machine..."

Suddenly, the vehicle sprang to life. It begin to rise off of the ground, and the panel in front of Thyme let loose a great hiss of steam and lit to new life. A dull hum was heard in the belly of the mechanical beast, and the mole fell back astonished. After a moment the machine seemed to have calmed, apparently awaiting an input from Thyme.

"What should I do?" asked Thyme, afraid to touch anything

"It seems to be waiting for you. Try pushing some buttons and levers and see what happens."

Thyme paused with some trepidation. He was not used to situations of discovery like the mole was. He was move comfortable solving the mystery once all the excitement had passed, but this was a new sensation. He was possibly the very first Animal... no, the first living creature to operate an ancient machine for over a thousand years. Slowly, he reached for a small button on the panel that glowed a soft amber.

"Get ready! I'm about to press something."

He pushed it, and a great roar went forth as a large panel at the side of the machine moved to reveal a giant barrel. With a loud explosion a shot rang forth from the machine and struck the chasm wall in the distance. The jolt knocked Thyme out of the chair where he was seated and he fell to the ground with a thud. After some seconds, the Inspector came to with a hard ringing in his ears. The mole was quickly beside him, yelling words that could not be heard. Thyme waved to signal he was alright and the mole helped him to his feet.

Thyme's head was pounding, but he stood and stared at the machine. The transformation was incredible, what once appeared to be a docile piece of metal was now undeniably a massive armament, a giant weapon of war with a barrel nearly ten feet long smoking and hissing from its side. Thyme's hearing slowly came back and he looked to where the barrel was aimed. As the smoke and dust settled, the face of the chasm now bore a hole too great to be seen in the pale light of dying day.

The mole was the first to speak, "How could a machine so small create a hole a hundred times larger than itself?"

"I do not know." said Thyme "But I think I know now what happened to the Ancient Ones. If there were hundreds of these machines like you say, then there must of been some use for their number. They may have been a great war centuries ago."

"But... if there were battles, wouldn't there have been more to find? More machines or evidence of fighting?"

"Perhaps. I don't have any more answers than you." Thyme stepped toward the machine. The heat of the blast could still be felt emanating from the barrel, and the transformation left much of the machine's innards exposed. "This discovery must be kept secret. If anyone were to see power of this kind, there could be consequences."

As the animals approached, the cog could be clearly seen, turning slowly. "I think we have made an incredible discovery, but also a distressing one. This gear is the key to knowing the mind and will of the Ancient Ones, and perhaps how they ended."

"But what should we do? Surely we can't just leave this machine here for the next person to find."

"No." said Thyme. He reached out and removed the cog from its spoke. The machine sputtered steam and returned to its original state, shelled and impotent. "No we cannot. But this is a larger puzzle than the both of us for now. We can only looked for other uses for this gear, and search in secret. I will take the cog for safekeeping. Continue the dig, and if you find any other ancient machine that look to be in good repair, notify me. We will discover what they do on our own, free from the eyes of other Inspectors and most of all, keep the Owners unaware. Something tells me this may be what they have been looking for."

"Very well." said the mole "If I find anything else, I'll let you know. I imagine that may be the only cog. There's no other movements detected by the wave analysis, and I'm certain no other mole squad as turned up anything like it."

They turned to leave the chasm. Night has already fallen, and Thyme was uneasy. This discovery was against everything he had been told of the Ancient, that old peaceable race. It weighed on him, the notion that perhaps the murder of Animals and these present events were somehow connected, but he could not see how. He felt as though he was being taken into a mystery that he would not escape. And slowly, the cog in his pocket, turned.

The Prison that Walked

2010-09-08T21:25:00.001-04:00

I am a guard. I am only one. I guard the prison and its inhabitants. I have no other function.

I go by many names, though I have no memory of a title from my maker. I am called Behemoth, Minotaur, Leviathan, Wormwood, and many other such names. I have no memory of what my title was.

I am large. I am small. I have no place, for I stay in no place for long. I guard the prison, or I am the prison. The inhabitants live inside of me. I move. I walk. I travel to no land and no time. I slip through dimensions and appear as the world would see me. Sometimes as a great beast. Sometimes as a small particle. Sometimes has a vast expanse of emptiness. I am strange. I am uncertain. Whatever I be, I become frightful to behold. I guard the prison and its inhabitants by fear, so that others would stay away.

My inhabitants number three. Three is all there are. Two of them sleep, but one is awake. He walks within me trying to escape the prison. He has been there a long time. I was made for him, and I guard him.

He is great. He is weak. He works to be what I am not so that he might leave. When I am small, he becomes large, hoping to break his cage. When I am large, he becomes small, trying to slip through unnoticed. When I move through dimensions and other worlds, he fleets and vibrates, trying to send small signals into the new reality around him.

He is in agony. He knows there are others but he cannot find them. He know who I am but he cannot petition me. I do not know his name or what he has done. I know I am his prison, and I was made for him.

I walk through space and time. I guard the prison and its inhabitants. I am only one, but I am many of one.

Back

2010-09-07T22:57:00.002-04:00

I've got a hankerin' to start this thing up again. I've been reading my old journals of late, and I realized how much I miss writing, even if it were the little bit that appeared here from time to time. I'll probably just use the site as a platform for some short story ideas and this post functions mostly as a place-holder for now, but we'll see how it goes.

Ghost Town

2009-03-07T20:24:00.003-05:00

My updates are sporadic. I apologize. I simply don't know what to do with this website. In bygone days, it was a flurry of activity. Now, like the proverbial ghost town of the age-old cowboy drama, there is nothing. I may write more someday. I might not. The future is uncertain and opaque. I'm only posting now because it felt like something to do. Hope against hope, at some point in the future, a shining rider named Inspiration with his trusty sidekick Dedication will come to this solitary town form a new law.

Here's hoping.

PS

2008-12-14T21:23:00.000-05:00

I've also turned the personal blog into a photo blog. Swing by when you get a chance.

Introduction to the Book

2008-12-10T17:28:00.002-05:00

I've started the discipline of writing a book. I shall post different plots, stories, segments, and ideas here. I ask that whomever chooses to read to comment. I humbly admit that in the beginning, it will be absolutely no good. But, I spend about an hour on it every night, so hopefully some day it will be. At least good enough to publish and make me some cash.

Conspiracy Theories

2008-08-12T19:33:00.002-04:00

I like video games. One in particular that I have enjoyed it is entitled Assassin's Creed. In it, a young man named Altair is the subject of history. he becomes the assassin of several prominent medieval figures. The timeline is set during the Crusades, and several aspects of the game are fairly historically accurate. Besides, what's more fun than gallivanting around the ancient middle east smiting whomever you desire?

Yet what is more interesting are the stories which the game introduces the player to. There are many conspiracy theories present within the game, many I have never heard of before. Some are common, like the influence of the Knights Templar in modern-day, or the role of pharmaceutical companies in the deaths of several African villages. But some I had never heard of before, like the Philadelphia experiment. That experiment was apparently the subject of a conspiracy theory that claims the United States Navy has the capability of making a destroyer-class ship virtually invisible to the naked eye. 10 years ago, I would have disregarded this story as pure science fiction and poppycock. Yet several recent stories in the science world had me wondering. I soon the government does not tell us everything. In fact, I believe there are technologies that are known to the war Department but not to the general public. If this is indeed a fact, the current trend of technology has made slightly frightened. There have been several stories published recently amazing advances in technology: specifically, the capability of producing a light bending field, the drastic reduction of production costs of LEDs, and the reality of teleportation. If these are indeed technologies that exist, and provide dramatic experiments for the common man, what sort of things do we not know about.

This line of thinking is, of course, the impetus behind conspiracy theories. As a fairly literate and scientific individual, I do not believe conspiracy theories to be true, however, there is truth in every story, myth or historical. For the time being all I can do is read these fascinating stories, ruminate on their significance, and pray that we all don't die tomorrow.

Untitled #1

2008-07-20T19:06:00.006-04:00

Death walked down a rain-soaked hill. The ground was moist and green, giving way a bit to the weight of each step. The sky was darkened and gray, still and cold. The rising fog betrayed the presence of downpour that left just moments ago. There were still rumblings and rumors in the air of a thunderclap that lived for but a powerful moment.

Death walked to the side of the road that was at the bottom of the hill. There was a mangle of steel, fire, and blood before him; an automobile accident. The smoke of the engine fire mixed with the surrounding fog, and the smell of burning flesh and oil saturated the air.

There were two noticeable forms in the car before him: a woman and a car seat. Death lowered his head and crouched down to get a closer view of those who would soon be called victims when he saw a picture catch ablaze close to the woman's hand. The visage of a man blackens slowly as the flames envelop the photograph. The smile he was wearing crumbled and falters to the heat around it. Then, its gone. Perhaps a husband, maybe a father, the relationship didn't matter anymore. It all burns away, here on the road.

Death rose and looked around, stepping from side to side to measure the situation. It was a tight curve around the hill, and the roads were wet; a simple mistake or miscalculation is all the happened. The tanker that was further down the road must have overturned, falling on top of the sedan, the resulting pressure and sparking starting the fire. The truck had jolted itself from the tank, and skidded a few yards ahead, separated from the wreck. Death walked towards it with his hands in his pockets, slowly watching the pavement and listening to the sound of crying.

Around the steely bend of the tanker, behind the truck was Earl. A large man with a scraggly, unkempt beard and clumsy hands. He wore a John Deere hat and a flannel jacket. It kept his body dry in the previous rain, but it could not prevent the moisture on his face. It stuck Death as being a silly image; a man of such build and stature cry as he did, kneeling with his face to the ground, pounding the pavement with a weakened strength.

Death knew. Death knew what his crying was about. It wasn't about the accident, or even the woman and child he killed. Earl had not yet known someone had died. He was crying because he was angry. This accident was the last straw, the final mark of a series of dark events that defined his life. This accident meant the end of his career, one the Earl didn't particularly enjoy, but Earl had bills, many bills, and a tab at his favorite bar. Add an alimony and child support to all of that, and you have the making of a poor, desperate man. No, Earl wasn't crying about the wreck. Earl was crying because he hated his life.

Death knelt down next to Earl and watched him for a moment. He watched as Earl retraced his sorry life in his feeble mind. He watched as Earl gasped at the realization that someone else might have been hurt in this accident. He watched as Earl stood up, bruised and broken, and made his way around the tanker. He watched as Earl smelled the air, sniffing the smoke and fog. He watched as Earl witnessed the blackened mass of the sedan and, clutching his arm, stumbled over to what was left of the woman and child.

The next few moments would be the most significant in Earl's pitiful life. Earl first noticed the color of the sedan underneath the flames and char. Through the black, a familiar red peeked through. One what was left of the hood was an ornament that belied a familiar make of car. Earl looked at the back to view a burned license plate. It singed his hand as he cleared the dust, but for some reason, Earl didn't feel any pain. His heart was beating too fast. His mind was too far ahead of himself. He began to shake as he read the familiar numbers of a car he had once owned, but had given away. Earl rose and looked to what would have been the driver's seat, to what would have been the hand of a woman he once loved. There was still a ring.

Then Death smiled with a note of surprise, remembering the image of the man in the picture. The face in the photograph was Earl's. Death watched as Earl's face contorted in fear and grief. He stumbled backwards and fell, his face transfixed on the fire. Then, he saw the plastic car seat and a small moan escaped from Earl's mouth. Death moved closer to Earl, hands still in his pockets, and tapped his foot twice when he stopped. It was the climax of realization that always excited Death the most.

Earl was frozen, wide eyed, staring at the wreckage. He blinked, and his demeanor changed. He stood, slowly at first, yet he was somehow calm and dignified, as if taken by some ideal or conviction. He stepped toward the sedan, sniffed and let out a little cough. Earl then turned and walked back to the truck with a deliberate pace. Earl didn't feel the burns on his hand or the bruises on his arm. The cuts on his face had clotted and dried, and he wasn't crying anymore. By all appearances, Earl was now strong and determined.

Death found himself struggle to keep pace with Earl.. He watched as Earl ripped the door from the truck, climbed in, and emerged moments later with an object in his hand.

It was an old hunting knife. Perhaps it wasa gift from a father to a son. Perhaps it was bought as a practical purchase. It didn't matter anymore. The knife had only one relationship with Earl now. Earl removed the knife from its casing and placed it on his neck. The moment of decision had come, had Earl paused. His resolved countenance fluttered and dimmed, and Death walked up slowly beside Earl, whispering softly in his ear.

"Do it."

Earl breathed and exhaled, and in one quick motion cut an arc across his neck. There was little blood at first, but more flowed and poured as Earl collapsed on the ground. There, beside his truck and yards from those he loved, Earl died.

Death watched it all and gave a little puff after a few silent moments. The crackle of the fire was still sounding, and the rain had started once again. The water pooled in the potholes of the road, and Earl's blood was running down the pavement, mixing with the oil and the gas of the sedan. Death is always a romantic, a poet at heart, and he was pleased with his newest masterpiece of tragedy here. He ran his hand across Earl's fading face, and took the hunting knife. Death stood, placed the knife in his suitcoat, and returned his hands to his pockets, walking slowly up the hill from where he came. The ground still gave way to his weight, the thunderclap that the rumblings foretold rang once more, and Death smiled as he contemplated how the world works.

Resurrection

2008-07-20T17:36:00.002-04:00

You know, Christ once did this "raising from the dead" thing, so I figured I'd give it a shot, too. We'll see how it turns out.

Moved

2008-01-15T19:24:00.000-05:00

Just in case anyone comes kicking around the ashes of this once-proud blog, be it known that I have relocated to The Experience.

Dear Internet,

2007-10-25T15:52:00.000-04:00

Once upon a time, there lived in this very space a tiny blog. Mightily did it struggle against the forces of time and the ravages of neglect, but in the end it was overcome, and it perished.

R.I.P. The Head Cult

That leaves me a blog widow, and now that I've had sufficient time to grieve, I'm thinking about dating again. Nothing serious, just lunch with that blog from down the street. Maybe a cup of coffee now and then. I'm still healing, after all. But this is for the best. It's what The Cult would have wanted.

I miss writing. I miss offering up my lovingly crafted ideas to be mercilessly shot down by anonymous strangers on the internet. I miss writing 2000 words on topics that no human on the planet, myself included, is interested in. Good times...... Good times.

So, I'm offering up this plea to the internet at large: Adopt Me!

Winter is quickly setting upon the Colorado high country. My employment status is once again uncertain. A new neighbor moved in with an unsecured wireless connection. The planets are aligning. I think the time is right. May the ghost of The Head Cult forgive me.

Don't count on me to match the output I had at The Cult during its prime. I'm thinking a couple posts a month or so.

Former readers of the Cult will be familiar with my particular brand of dreck. If your blog needs a couple thousand words of filler every month, I'm your man. Just to refresh your memory, here are a few of my past diatribes and ramblings:

The Climate Prize
Constitution for the Common Man
Quran Controversy
Original Intent

Dear Internet, I have already run one blog into the ground. Who will be next? Adopt me!

Social Justice

2007-07-18T15:13:00.000-04:00

You remember that scene in the movie “Seven” when Brad Pitt, Morgan Freeman, and company walk into that apartment, air-fresheners strung everywhere, and find some “dead guy” tied to his bed – except he wakes up and starts writhing and gasping? This is the blogging equivalent of that.

I have a problem with the social justice movement – not that I think its unnecessary or wrong or bad, though I think some off-shoots from it can be misguided. No, it’s the name that I don’t like. Social Justice. I think it’s got a bad title and here’s my reasoning:

In our world, nay in our universe, justice is by and large the rule. God has designed our lives (and I say “our” lives to mean human lives) to follow a pretty uniform standard of justice. This is from the big-wigs of corporate America to the poorest of poor, the most plighted of the disadvantaged in…geez, just pick a place – you get what I’m driving at. I would say, for 99% of the world justice is served. Now, one might counter and say there most certainly is NOT justice in our world. How could you even say that with so many innocent children going hungry every night or getting sold into child prostitution or suffering from AIDS if there truly is justice? To say that is preposterous, calloused, and downright uncompassionate. Well, here’s my rationale behind the statement.

I don’t think we can pin down justice to being only personal – eye for an eye, ear for an ear thing. Sometimes that’s how justice works, but most often justice works as a long term, cultural slant, and in my view, in that line of thinking, justice is served almost without exception. We here in America are getting “our” just rewards, just as those people of backward, third-world countries are getting “theirs.” That may sound horribly elitist, “un-globally” minded (which seems to have become the unpardonable sin these days.) but let me explain what I mean. True “social justice” rarely serves those who work the hardest for it. We would all agree that the general order of things follows this basic pattern – “do the work and enjoy the product of the labor afterwards.” We all know this to be true. We all work for a week, sometimes two, and then receive a paycheck. We cook a meal and then eat it. We study and go to class and then receive the degree. Etc, etc, etc. We’re all familiar with this principle. Rarely in life does that natural course reverse itself. I seldom get the pay-off at the beginning and then do the work for it later (except in what the general populace would call deviant behavior) In that same way, I think the natural justice of life works. Our forefathers before us for the most part, worked extremely hard to build a culture that would be prosperous and righteous. A lot of them never got to see the rewards of their work. Think about the men that fought in the Revolutionary war or the settlers on the frontier plains or the civil rights/women’s rights workers of past decades and centuries. A lot of them never got to see the just rewards of all of their hard work. In fact, a lot of them lost everything for an ideal that they never saw come to fruition. One might say, they never got true justice in their life, but justice doesn’t work that way. Justice is a slow, plodding, methodical entity that always delivers, but rarely when we want it to. In fact, if truth be told, I seldom receive right now the justice my actions deserve.

Just this past week I was at Nazarene Youth Conference in St. Louis, and I’ll be darned if on the way back I didn’t average about 12 mph over the speed limit. Now, I didn’t get a ticket – in fact, I don’t think I’ll ever get a ticket for my heinous, reckless abandonment of the law during those 2 days of driving. I have cheated the system - thoroughly bamboozled the element of justice in our society. Or have I? Very likely, I’m not the only one who sped during the course of my trip. In fact I’m willing to bet that most of us on the road were traveling at an excessive rate of speed and probably a few at a dangerous pace. And, I’m willing to bet, during that time there were accidents where people got hit and injured by someone going a little too fast. Those people that got hit weren’t necessarily doing anything wrong. They were just innocent bystanders driving their cars at normal rates of speed, but, that’s usually how justice works. The actions of the general public affect the public as a whole. A general disregard for laws and "rightness" will often affect people who had no part in the disregarding simply because they're part of the group. Actions done today will influence other actions done tomorrow will influence trends next week will influence cultural directions a year from now. This is why I think it’s true that “Righteousness exalts a nation but sin is a reproach to any people.” My sin can very easily become your sin, can very easily become our sin, can very easily become our nation’s sin – and then we feel the effects.

Now, don't take this to mean that I think excessive speed on the highways is a major socially debilitating concern. I was just using it as a simple illustration to make the point that: I think the nations, the people, the cultures that promote destructive behavior either through turning a blind eye to wrong doing or by blatantly advocating improper practices will soon rain down the rewards of that behavior on the people. If a culture doesn’t place a heavy emphasis on education or adopts an inefficient, corrupt educational system, their populace will eventually reap the rewards of it. If there is a constant power struggle among warring peoples which keeps an economy from flourishing, you can rest assured that in time the people of those cultures will experience hardship. Justice will be served – we don’t need to advocate for it. He’ll always be there eventually.

No, I would submit that instead of social justice we should call it social mercy. If I remember correctly, Jesus almost never pushed justice among our human relationships. He knew that would happen naturally. He was constantly telling us to turn the other cheek and go a second mile for our fellow man - to feed the hungry and clothe the naked. Jesus pushed mercy because He knew it would help break the cycle of justice that our sin so rightly deserves. He knew His act of mercy was the only thing that could save us and an act of mercy from a fellow human would push us towards that ultimate act. If we could see it in this light, mercy is the broken link in the chains of justice that bind our human existence. Now, this isn’t to say that justice is bad or shouldn’t exist. God created our system to work this way and if you remember, He called all of His creation good. I would just encourage everyone, there’ll be plenty of opportunities for justice.- when you get the chance, show mercy.

On a similar note, why is it that truckers seem to be the only group that has to constantly justify their professional existence. No one else feels the need to do that. You always see, trucker t-shirts and hats with things like “truckers keep America rolling” or “If you got it, a trucker brought it” or “Without truckers, the only thing you’d have to put in your mouth would be your foot.” (all found on trucker t-shirts). No one else seems to have this inferiority complex. You never see nurses wearing shirts like “How’d you like to draw your own blood, buddy” or chefs wearing shirts with “I’m the only defense between you and an unhealthy dose of e-coli.” I even remember talking to a couple truckers. They seemed really peeved at life. Maybe we need to start a social justice movement for truckers.

A Few Proposals

2007-05-20T16:58:00.000-04:00

Hey, all.

I'm in the process of writing some papers for the Wesleyan Theological Society conference next year, and I am about to post my paper proposals for your enjoyment/displeasure. If you are interested, you could please read them and provide feedback via the email link attached to my picture on the right, I would greatly appreciate it.

Also, I'm quickly developing a practice of writing short stories each Sunday during church, and was wondering if anyone would be interested in reading those. I may post them, but I feel somewhat ashamed, being around such well read individuals, and its rather a risk on my part. But, I would like to develop a better reading ability, so if any readers are with me, I suppose I could try it.

Enough. Here are the current state of my proposals:

Science and Theology Proposal:

Relativity, Quantum Physics, and Retrocausality: Creation Theology in Light of New Scientific Trends

In this continuing age of reason, the tension between science and religion seems stronger than ever. Recent breakthroughs in science continue to raise ethical questions as to our response to humanity, justice, and God. The rule of cause and effect has dictate the direction of science, but has little to say to the One who has no cause. The question that theologians beg to ask is this: where is God in this world of science?

In my paper, I hope to introduce the science of retrocausality and its effects to Creation theology. This will include a brief overview of the sister sciences responsible for the creation of the theory of retrocausation: quantum physics and the theory of relativity. I will explain the fundamental concept of retrocausality, its implications on the principle of cause and effect, and how this could inform Creation theology and the revelation of God.

Retrocausality is the theory that bridges the sciences of quantum physics and relativity. Photons can be measured as either particles or waves. Protons can be "entangled" to one another; actions affecting one will also affect the entangled twin, regardless of time or distance. If we were to measure one photon as a particle, it would force its entangled twin to be measured the same way, regardless of time or distance.

This interaction suggests either faster-than-light travel, or a present interaction with the past that dictates how both entangled protons will act.

Fundamentally, this could mean that in a world of sequential events, and effect could occur before its cause. The present could affect the past, or the future could affect the present.

I believe retrocausality, better than other sciences, gives us a view into the perspective of God, a view that is unhindered by time and linear observation. It is a realm that is eternally now, where all things in both past and future affect the present. It perhaps gives new insight into how God view perceives and created this world.

Christian Formation/Systematic Theology Proposal:

In Scripture, we are often confronted by strong language. Christians are told to "take up their cross" and "die to sin." Traditionally, these intense Scriptures have been read as metaphor, and have had little to no literal interpretation. But what if God's call to die was a call to physical death? If Jesus conquered death on the cross, why is death still a part of this world? If there are those who are forgiven and reconciled to God, why must they die?

Using a systematic perspective of Scripture, I propose that death is a requirement for processional holiness. I also propose that there are two kinds of death; one obedient to God, and one that serves the self, and that these two deaths are so distinctly different, that their response has a profound effect on holiness. I propose that the moment in which God was most intimate with mankind was in the physical death of His son, Jesus, and that now the moment in which mankind can be most intimate with God is also in a physical death. This essay will offer discussion concerning the the relationship between holiness and the physical death, process sanctification, the impassibility of God, and martyrdom. From this perspective, the dead are, as Arthur Hertzberg describes, “too holy.” That is to say, the dead experience holiness in ways only the living can imagine.

Bachelor Menu

2007-05-19T21:36:00.001-04:00

I’ve been a bachelor for close to a week now. Christine took the boys Monday morning to spend some time at her parents’ place in Texas. I stayed behind because of work and because I need to get ready for a class I’m teaching this summer. We didn’t have a chance to grocery shop before she left, so I’ve been getting pretty creative about food this week. I’ve made it a bit of a game, trying to see how empty I could get the refrigerator (which was already quite empty when she left) before I was forced to do any grocery shopping on my own. Here is how I’ve faired so far (and still no trip to the store . . . except to get dog food. But that wasn’t for me.)

Basically I’m all set for breakfasts. I’ve never eaten much breakfast anyway, and there was still a stash of yogurts in the fridge and half a loaf of banana bread, so that’s been no problem. Lunch and dinner are what’s tricky.

MONDAY

Lunch: I can’t remember.

Dinner: hot dogs.
These were the last hot dogs in the house. Christine’s not even been gone a day yet, and already things are getting dicey.

TUESDAY

Lunch: fried Cajun sausage sandwich.
Down here they do a thing called a fried hotdog sandwich, which is exactly what it sounds like. There was a package of three large Cajun sausages in the fridge leftover from last time Christine made her famous Cajun chicken pasta, so I’ve tried to build as many meals as I could around that. This was the first. Slice the sausage lengthwise, throw it on the George Foreman, and then toss them on a bun and top with mustard. Not bad, but I’m not sure I could do it for a week.

Dinner: Campbell’s chicken noodle soup, supplemented with Ramen noodles.
The other staple left in the kitchen was a box of Ramen noodle packets. They would be the second pillar upon which to build my meal plan for the week. They worked well in the chicken noodle soup, because I’ve always thought Campbell’s soup was too watery and had far too few noodles. This was the last can of soup in the house.

WEDNESDAY

Lunch: mashed potatoes and Cajun sausage.
I fried the sausage on the George Foreman again. When we were in England we went to a pub once with our parents, and Christine’s dad ordered what seemed to be a normal British meal of “sausage and hash” or something like that. It was basically a mound of mashed potatoes piled on some sausages. I figured I’d try it here. The mashed potatoes were left over from last week. Again, not stellar, but I think I get some bonus points for a cross-cultural meal.

Dinner: pizza at church.

THURSDAY

Lunch: Ramen noodles.
Someone told me that Ramen noodles were very high in sodium, so I only poured in half of the flavoring packet. Surprisingly, it doesn’t hurt the taste much.

Dinner: BLT sandwiches.
Score! Found some bacon in the fridge, along with a few tomatoes and a head of lettuce in the crisper. I have no idea how long the bacon had been there, but this meal was probably the culinary high point of the week.

FRIDAY

Lunch: Ramen noodles.
They’re not getting old yet.

Dinner: ate out with some friends.
I ordered Cajun sausage. (Not really.)

SATURDAY

Lunch/dinner: fried Cajun sausage sandwich with cheese.
For the last Cajun sausage, I took the sandwich to the next level, frying the whole thing on the George Foreman panini-style and topping with provolone cheese (another fridge bonus find) and Grey Poupon. Not bad at all, but I probably shouldn’t have made more than one.

My friend told me the other day that he read, in a table of risks, that being an unmarried male was listed as a risk that could take up to ten years off your life. I didn’t believe him at first, but now I know why.

Attempted Fixes

2007-05-19T14:30:00.000-04:00

So...I haven't been to the site for a while, and things looked a little strange...

I fixed things, I think. This doesn't mean any posts will happen, though. I just wanted The Head Cult to look presentable for her funeral.

I Scoot

2007-05-07T21:15:00.000-04:00

Here is a picture of our vehicles. Now that we are a clan of four, we have upgraded to the Town and Country. I viewed this as a necessary evil, but it's a suprisingly nice ride. I told Christine though that the next vehicle we purchased would be my long-desired scooter. I didn't realize it would happen so soon. A friend of mine is graduating and needed to get rid of his, so I relieved him of the burden.

Now I am a proud owner of a 2005 Honda Metropolitan. It has a 49cc engine (which another friend helpfully pointed out is approximately the same size of his chainsaw motor). It tops out at about 40 mph (maybe 45 downhill). And, according to the exhaustive Excell spreadsheets the previous owner maintained, it averages between 70 and 90 miles to the gallon.

I'm excited. It's fun. I got the helmet, the sweet goggles, and the motorcycle endorsement on my license. (In Mississippi, apparently, "E" stands for motorcycle.) It's got a luggage rack on the back, storage for the helmet under the seat, and a basket on the inside of the faring on the front. The twins don't seem too excited by it, but Christine likes it. She hopes that when I "step up" to the 250cc Piaggio, she'll get this one.

We'll see how parking works out. I'm not sure if I should treat it like a bike, hop it onto the sidewalks, and chain it to the bike racks or if it should be parked more like a car and take a full spot to itself. Apparently no one down here really knows what to do with them. I'm sure it would be much clearer in California. We'll also see how sharing the road with Hummers and the Oxfordian assortment of Land Rovers goes.

More posts as events warrant. If anyone runs across any Autobot sigil decals in kiwi green or white, let me know.

For Amy

2007-04-24T11:35:00.000-04:00

This post contains links to information requested by Amy. Everyone else, feel free to scroll on down to Steve's Podcast Extravaganza.

2006 Illinois Firearm Deer Harvest, by County
(via Illinois Department of Natural Resources)
*Good numbers, but they don't include deer killed by bow.

2005-06 Illinois Public Hunting Areas Report
(via Illinois Department of Natural Resources)
*Tons of charts and graphs showing hunting statistics for all different species. All info is in pdf format. Gives info like "total number of hunting trips" and "deer harvest by bow" for all the public hunting areas in the state. The downside is that it only gives data for public hunting areas, and doesn't include private land, which is the vast majority of the state. Also, the charts aren't particularly well-designed, and some of them are hard to read.

Managing Illinois' Deer Population
(via Illinois Country Living Magazine)
*Nice article written by the Director of the Illinois Department of Natural Resources. Outlines IDNR's goals for the deer population and how they're trying to reach them. Unfortunately, the whole thing is 10 years old.

Deer Dilemma
(via University of Illinois)
*Short news article detailing possible deer overpopulation, specifically in Robert Allerton Park. This is a single case study, not a statewide view.

Illinois Deer-Vehicle Accidents, 1989-2003
(via Illinois Department of Natural Resources)
*Stats showing a steady rise in deer-vehicle collisions over 14 years. Could mean that the deer population is on the rise, and perhaps too large. Could also mean that the vehicle population is on the rise, and perhaps too large.

---
That's all I've got. It was surprisingly difficult to find a simple chart of the state deer population from year to year. If I was doing this paper, my next step would be to contact the Illinois Department of Natural Resources directly. This is their website:

dnr.state.il.us

Showing that there are a lot of deer in Illinois will be easy, but proving that there are too many deer in Illinois will be harder. Your student will have to dig up some numbers from a biologist about the ideal deer population. Again, I'd start with IDNR.

Good luck to your student. I'd be interested in the results of the endeavor.

Podcasts

2007-04-21T14:30:00.000-04:00

I could write a post about babies, but I'm not going to. Instead, I'm going to write an introductory post to something slightly less exciting, though quite useful and interesting nonetheless: podcasts.

My in-laws got my wife and me each ipod Nanos for Christmas this year. I was quite pleased, not only because now I'd have something with which to listen to music on my way to school, but also because I'd finally be able to figure out what the big buzz was about podcasts. I'd been hearing about these things for a while, but lacking an ipod or other digital music device, I was unable to explore this particular medium myself. Were they shows? Was it like having a radio or more like listening to a book on tape? These are things I wanted to know.

Well, I'm happy to report that I've ventured into this exciting new realm and found it indeed rich and fruitful. A podcast is kind of like a radio, except you can listen to the shows whenever you want. It is like having a book on tape, except . . . um, it's a lot smaller and easier to carry around than a walkman. Music, philosophy, history! Such a cornucopia of useful and interesting things to listen to! And all free!

However, to a beginner with not much time to spend perusing the iTunes iPod store, the initial scope of selection can be a bit intimidating. This is why, with my limited experience, I've put together a list podcasts to which I subscribe that I think may be of interest to the limited readership of this blog. So, without further ado, the content of "Steve's Ipod Podcast Selections":

Great Speeches in History (http://www.learnoutloud.com/Catalog/History/Speeches/Great-Speeches-in-History-Podcast/21306)

Who wouldn't want to walk to school hearing the speech Socrates gave in his defense before being put to death? Or hearing St. Francis' sermon to the birds? Or Pericle's funeral oration? I know I wouldn't . . . not want to walk to school . . . hearing those. Basically, you can find some great podcasts at LearnOutLoud.com. This is one of them. Every week or so they feature a famous speech read or sometimes from the original recording.

KEXP Song of the Day (http://www.kexp.org/podcasting/podcasting.asp)

I don't know much about contemporary "hip" music, but I'm learning. KEXP seems to be the place for today's indie music snobs, or people like me who would like to be indie music snobs and don't have the time or the money to buy a lot of new CDs. This podcast is pretty self-explanatory, but I like it a lot because of the wide range of music they feature. If you don't like the song today, give it a couple more. You'll eventually come across some random band you've never heard of but now love, and you can be a music snob too. (The point of being a music snob is appreciating bands no one else has ever heard of because they're too ignorant and because you have excellent taste.)

Naxos Classical Music Spotlight (http://www.naxos.com/podcasts/podcastslist.asp)

I didn't know this, but apparently Naxos is the leading classical music label in the world. What I did know is that every couple weeks they release a podcast that highlights some new recording of classical music. The catch is that the podcast is basically a twenty-minute advertisement for this new Naxos album, but along the way you get to hear long selections and a host who gives you some of the history behind the composer or style or collection or whatever. The first one I heard was on the medieval choral music written for the Notre Dame cathedral, and I was hooked. I haven't bought any albums from them yet though.

NPR's All Songs Considered (http://www.npr.org/rss/podcast/podcast_detail.php?siteId=4819413)

This is another podcast to help you be a music snob. If you like emerging artists (i.e. music that the "cool kids" are listening to) and you can abide a slightly irritating host, I recommend this one. In fact, this is probably #3 of my "top three" podcasts. A new one comes out every Thursday (I like consistency), plus they often have special podcasts of live concerts. A recent concert was Explosions in the Sky, so that's a plus. Another plus is that every year they have a listener-voted best albums list, and for 2005 Sufjan and Bright Eyes were at the top of the list. These are people I can get along with.

The History Network (http://www.thehistorynetwork.org/TheHistoryNetwork/The%20History%20Network.html)

My #2 podcast. I have no idea who these guys are, but they make good podcasts of "essays in military history". Each episode is a complete essay-- no book segments or anything like that. You get to hear about the battle of Marathon or Marshall Zhukov or the Gurkas . . . all sorts of fascinating military history things you never even realized were interesting (except the battle of Marathon, which I'm assuming you already heard about and realized was interesting). The single drawback is that the narrator feels the neccesity of adopting "accents" when he's reading a quote by a person of another nationality. Other than this, a very well done podcast. This week's episode is about Alexander the Great. Hurrah!

The Philosophy Podcast (http://www.learnoutloud.com/Podcast-Directory/Philosophy/History-of-Philosophy/The-Philosophy-Podcast/19669)

My #1 podcast. Another great offering by LearnOutLoud.com. What's better than being a music snob? Being a philosophy snob! Or at least pretending to be one while listening to excerpts from the works of philosophers while you walk to school. This is not a podcast to listen to while sleepy, but for the most part the readings selected are excellent and the narrators professional. Great "brain floss" for the trip home. It almost is enough to make you go out and pick up one of the books, which is probably the entire point. And if that doesn't sell you, you could always listen to the episode from a few week's back: Bertrand Russel's "The Value of Philosophy". He's convincing.

Well, I hope that helps. Or at least convinces you that your ipod is more (much more) than a portable CD shelf.

On Celebrities

2007-04-15T23:33:00.000-04:00

I attended a church in Hollywood today, and I saw my first live celebrity. This is who it was:

This is Tony Hale, or better known as "Buster" from the unfortunate sitcom "Arrested Development."

It wasn't as groundbreaking as I had imagined it would be. I suppose it does represent a full saturation into Los Angeles culture, but I think I was expecting more pizazz. Don't get me wrong; it was all very exciting and thrilling, but there was a distinct experiential void at the end of the whole process.

But I'm sure one of the few readers of the Head Cult, Richard McElroy, will be envious.

Free Will

2007-03-31T11:43:00.000-04:00

I think that this is very interesting:

http://www.ft.com/cms/s/81bc32e4-d5e3-11db-99b7-000b5df10621.html

Have a nice weekend.

On Children

2007-03-29T23:04:00.000-04:00

For everyone else out there, Steve and Christine now have twin boys. I want to extend the right to tell the story to Steve and/or Christine, but I just wanted to let the reading public know.

May the congratulations and condolences ensue.

On Learning

2007-03-27T13:24:00.000-04:00

Apparently, Dietrich Bonhoeffer is the greatest ethicist known to man.

That is all.

Current Controversy

2007-03-23T11:58:00.000-04:00

(SNOOZE-FEST ALERT: Sweet sassy, I can turn anything into 1000 words.)

In response to Mr. Vidt's post, I'll attempt to explain the current controversy over the firing of eight federal prosecutors. This should have been a comment, but it was too long, if you can imagine such a thing.

The Bush Administration recently fired eight federal prosecutors from the Department of Justice. To understand how this case works, you need to know a little bit about federal prosecutors in the Department of Justice.

DOJ prosecutors are not like the criminal prosecutors you see on TV. They are appointed by the President. They spend very little time in court rooms. They spend a lot of time managing people, investigations, and cases. They are ultimately in charge of how investigations are conducted, deciding which cases are pursued and which are dropped. They are often in charge of investigating and prosecuting cases against U.S. Representatives, Senators, and other high-level politicos.

DOJ prosecutors get fired all the time. When Reagan took office in 1981, he fired all the DOJ prosecutors. All of them. Clinton did the same thing in 1993. Fired every last one. Bush Jr. took a little longer to do it, but within a year, he had replaced them all. This happens all the time. The AP puts it like this:

Nobody disputes the president's ability to fire or not renew the jobs of federal prosecutors. They're political appointees who serve at his pleasure.

Basically, they're political hacks.

The Democrats say that these last eight firings were even more politically motivated than usual. They say that these eight prosecutors were fired because they either spent too much time investigating Republicans or not enough time investigating Democrats. Some of the fired prosecutors claim they were pressured by Republicans to pursue certain cases and drop others.

The DOJ answers to Attorney General Alberto Gonzales. Gonzales' top aide has already resigned and accepted responsibility for anything inappropriate that may have happened, although the Administration still claims that nothing inappropriate happened. The Administration claims that all eight were fired for legitimate reasons, although I don't think that those reasons have been made public.

All the Democratic Presidential hopefuls are calling for Gonzales' resignation. It's practically a sport. Thus far, Bush stands by his man.

Many people are not aware that Congress has the power to issue subpoenas, just like a judge or court. The difference is, Congress has the power to issue subpoenas to whoever it feels like, for whatever reason it feels like. (They just have to come up with a justification for being interested in the case. Honestly, any excuse will work. It's not very hard.) If Congress wants you to come testify before them under oath, you have to do it.

This testimony carries all the obligations of regular court testimony. You can be convicted of perjury if you lie under oath. These are the subpoenas in question in this case. Congressional subpoenas, not criminal ones.

Congress wants to investigate the case, which they have the power to do. They would probably subpoena Gonzales, his top aide, a bunch of DOJ personnel, and a bunch of White House staffers. Congress would subpoena Karl Rove, because as Bush's top political advisor, he would likely know if those eight prosecutors got fired for political reasons. Congress might even subpoena Bush himself. That would be fun. (There is essentially zero chance that this will happen.)

The Administration has said that it will provide White House staffers to be questioned by Congress, but not in public, not on the record, and not under oath. Reading between the lines, I think the implied meaning is that the Administration won't cooperate with Congressional subpoenas. They'd either try to fight it in court, or maybe just refuse to testify. Everyone could just take the 5th Amendment or something. I don't know what their plan is.

The Administration is fighting this because the whole thing is a partisan battle. Look at it this way; the Democrats will haul as many people as possible in front of a Judiciary Committee meeting and ask them about a million different questions. The Democrats will be looking for one of these two results:

1) Nobody will be able to explain why those eight prosecutors got fired. The Republicans will look stupid, especially because very few people realize how the DOJ prosecutors work.

2) Somebody will lie under oath, hopefully Rove or Gonzales, and then they can have a big trial and haul some Republican bigwig off to jail.

Even if neither of these things happen, the Dems still get to have a big hearing, the public thinks that they're "getting things done," and everybody gets lots of face time on CNN. Only 11 months until the primaries, after all. It's a winner for the Democrats all around.

If the Bush staffers are smart, they'll go along with the subpoenas but answer every single question like this:

"The eight prosecutors were fired because the Administration felt they were not adequately performing their duties."

There is no law that says you have to explain why you fire DOJ prosecutors. You can fire them for whatever reason you want. You can fire them because they looked at you funny. You can fire them because it's Tuesday. It's legal.

If the Bush staffers stick with my one-line answer, nobody will get backed into perjury. Nobody goes to jail. And the TV coverage of the hearings would be impossibly boring. Nobody will watch Karl Rove saying the same thing over and over. Nobody will watch the hearings at all, and the Dems won't get so much of that precious TV face time.

Damage control, baby.

On the other hand, if the Administration makes good on its threats to refuse Congressional subpoena, it would set up an enormous Supreme Court battle over Congressional subpoenas, separation of powers, and the autonomy of the executive branch.

That could be fun, too.

On Misunsderstood Laws

2007-03-22T22:10:00.000-04:00

In the process of discovering why eight Federal prosecutors were dismissed of their duties, the White House has restricted the use of subpoenas by the prosecution, and Democrats are working to undo this action. Karl Rove is apparently in the know about something, but the White House doesn't want anything said under oath or transcribed.

My question is, what does it matter if there is a statement on the record or off the record, under oath or no oath at all? It seems that if the truth were the real intend here, I would to take all the transcripts, and all the oaths possible. Perhaps it may be just me, but I'm a little confused as to what is truly at stake here. All I know is that eight lawyers were fired for some reason, and there are people in our government that don't want other people to know why.

This confuses me.

The word "subpoenas" is also quite challenging to spell. I had to check it three times.

My Big Problem

2007-03-22T12:07:00.000-04:00

In order to explain my big problem, I’m going to use an example. That example is Intelligent Design. Intelligent Design is not my big problem. Intelligent Design is just the example. Everybody clear on that?

I strongly disagree with the Intelligent Design movement. I think it is poor science. In fact, I think it is not science. What’s more, I think it is poor theology. The details and reasoning are not particularly important, because this is merely an example.

The Intelligent Design movement and I get along fairly well, for the most part. I am perfectly content to let other people think whatever they like, and for the most part, the ID-ers are content to let me do the same. Sure, they try to convince me to think differently, but I don’t mind that so much. I’m happy to hear their views, for the most part.

But then troubles begin to arise. Certain people want Intelligent Design taught in public schools as science. I have a problem with that. While I personally don’t mind hearing what ID has to say, I certainly don’t want it taught as science to school children, because – as I mentioned earlier – I don’t think it’s science at all. And I definitely don’t want to finance the whole venture with my tax dollars.

My first instinct is to try to persuade my opponents. But through my personal experiences, I’m becoming increasingly skeptical that adults can be persuaded about ideas they feel very strongly about. It’s been my experience that once people form a strong opinion, they will continue to believe it no matter what evidence they are presented to the contrary.

Sure, there is the occasional oddball who has a drastic change of opinion, but as far as I can tell, those cases are rare – certainly not common enough to put a sizeable dent in the Intelligent Design ranks. So my first instinct is persuasion, but I’m beginning to think that persuasion is mostly useless with people who have already made up their minds.

The issue is further complicated when I consider the motives of my opponents. I think that the vast majority of Intelligent Design proponents are true-believers, seeking only to make the truth known. I believe they have my best interest at heart, and their actions are intended to make the world a better place. They are literally trying to save me from hell - no small task, to be sure.

If I were in their place, I’d just take the lazy route and leave people like me to burn. I know this, because that’s exactly what I did when I was in their place, not so many years ago.

My opponents’ cause is significantly nobler than mine - I’m just a cheapskate who doesn’t want to pay any more taxes.

And so I approach the debate knowing full well that my only weapon – persuasion – is useless. My opponents hold the moral high ground, and their motives are above question. Filled with a peculiar mix of empathy and hopelessness, I resign myself to writing wishy-washy, indecisive blog posts and waiting for the world to change.

That is my big problem.

Allegiance

2007-03-20T12:43:00.000-04:00

(SNOOZE-FEST ALERT: 1300 WORDS)

Tom Rawles is a City Councilman in Mesa, Arizona. Mr. Rawles refuses to stand and recite the Pledge of Allegiance during City Council meetings. He plans to continue to do so until U.S. troops are withdrawn from Iraq or his term of office ends in 2008.

This post is not about Tom Rawles and his somewhat peculiar war protest, but rather about the Pledge of Allegiance.

-----

I've always had a funny feeling about the Pledge. I wonder sometimes if we are blinded just a little by our lifelong familiarity with the Pledge of Allegiance.

As an exercise, I have re-written the Pledge of Allegiance using a thesaurus. Also, for effect, I have re-written it for Iran, rather than America. This is my re-written pledge:

I promise loyalty to the banner of the Islamic Republic of Iran
And to the democracy which it represents
A single country below Allah
Inseperable, with freedom and fairness for everyone.

It's not perfect, but I think it captures the spirit. It sounds a little weird, doesn't it?

One of the things that always made me uncomfortable about the Pledge was the way that we expect school children to recite it every day. How can an 8-year-old kid swear loyalty to America? Do they have any idea what they're saying? Is it a good idea to require kids to recite a promise that they don't understand?

Imagine school-aged children in Iran reciting my fake Iranian Pledge every day. Would that make you uncomfortable? Wouldn't it feel a little like indoctrination? Wouldn't it be just a little creepy?

I fully realize that American kids are not required to recite the Pledge. There are opt-out procedures and each kid is free to do as they choose, but they are certainly expected to recite the Pledge, and that kind of pressure is very powerful for an 8-year-old.

I have encountered many churches which will not accept professions of faith from kids below a certain age. Young children are probably not capable of understanding that kind of decision. Why should the Pledge be any different? Why should we ask kids to promise something that they probably don't understand?

What exactly are we trying to accomplish by having kids recite the Pledge in school?

Then I came across Tom Rawles and his interesting protest in Arizona. It got me thinking about the Pledge of Allegiance for adults. Exactly what promise are we making every time we attend a city council meeting or a public school function?

For Tom Rawles, "I Pledge Allegiance" is clearly conditional. Mr. Rawles pledges allegiance only when his goals and the goals of the nation are aligned.

If "I Pledge Allegiance" means "I Will Obey," then I'm in the same boat with Mr. Rawles. I will obey the United States Government only as far as our goals are reasonably well aligned. If the U.S. starts running concentration camps, my "allegiance" to this country will quickly end. If the U.S. decides to invade Canada and tries to draft me as a soldier, you'll find my "allegiance" has moved to Fiji.

I suspect that the bulk of the public agrees with me, in principle. For everyone there is a line, and once the country crosses that line, they'll no longer remain in allegiance with America. What about you? When you pledge allegiance, does that mean "no matter what?"

I got curious and looked up "allegiance" in the dictionary. I assumed the word was a form of "ally." America and Canada are allies, so we are in "allegiance." My country and I are, in a sense, allies. Thus, I pledge my "allegiance."

I was wrong. (What I was thinking of is "Alliance.") Allegiance comes from the word "liege," left over from the feudal system. The ruler was called the "liege lord" and was bound to protect his "liege subjects," who were bound to obey the ruler.

The term eventually evolved to mean, "the tie which binds the subject and the sovereign," and was frequently used to describe the relationship between England and the Queen or King. Allegiance runs both ways, which is comforting in terms of the Pledge. The king owes just as much allegiance to his subjects as they owe back to him. But there is still a king, which is a little confusing.

What is "the sovereign" to which we daily pledge our allegiance? Is it the Constitution? The government? The will of the majority? The allegiance system gets a little messy when there are not clean lines between the ruler and the ruled.

I am reminded of a section of Orthodoxy, by G.K. Chesterton. In it, he wrote that the best way for a man to influence an institution is to love it unconditionally. He spoke of a dreary mental institution in his day, and predicted that if a single person would love it unconditionally, it would become grander than a palace. After all, a mother doesn't tie a bow in her child's hair because she thinks the child is ugly without it, but rather because she loves the child.

I'm summarizing from what I remember, but I think I'm getting the main point across.

Chesterton went on to write that a man should love his country unconditionally, and only then will he make it better. If a man loves England because of its freedom, he will overlook and rationalize those areas where England denies freedom. If a man loves England because of its courts, he will overlook and rationalize when the courts fail. But if a man loves England simply because it is England, he will see her with clear eyes, help her where she is weak, and correct her when she is wrong.

Chesterton's view of patriotism and citizenship is like the relationship between a parent and child. The citizen is the parent who will love, help, admonish, and correct the nation. The patriot loves his country unconditionally, but he does not obey it.

The Allegiance System has the roles reversed. The nation (or king) is the ruler, and the citizens are the subjects. The nation is the parent, which we all must honor and obey. The patriot obeys his country, whether he loves it or not.

It seems to me that our current Pledge of Allegiance is rather fuzzy on exactly what kind of relationship exists between man and country. It seems to me that the Pledge has become a brainless, rote exercise. We're no better off than the 8-year-olds who recite it daily in their classrooms. We don't understand what we're pledging our allegiance to, either, and we surely haven't pondered whether that is a good idea in the first place.

I think the Pledge needs an overhaul. As it stands today, it's nothing more than a ritualistic, empty promise, and I've got a problem with that. A promise should mean something.

If the tradition of a Pledge of Allegiance is to continue, it should be re-written to clarify what exactly we are promising to do. If it is to have any meaning at all, the Pledge should be a promise, a solemn vow. It should be spoken after careful consideration. It should be uttered only by those who sincerely mean it, and thus should be completely optional. Mere children who cannot understand what they are doing should be actively discouraged from speaking the Pledge of Allegiance.

At the very least, the practice of reciting the Pledge of Allegiance in the public schools should stop. If this nation is everything that we claim it is, our children will come to support it in their own time, on their own terms. We would do well to spend our time creating a nation worthy of our children's loyalty, rather than waste our time compelling our children to swear allegiance to it.

Link

2007-03-19T12:21:00.000-04:00

Do you like science?

Are you prepared to read 2000 words on particle physics, quantum mechanics, and photons?

Do you enjoy trying to understand things that you will probably never understand?

Do you like to think about things?

Can you handle a ridiculous, misleading, two-paragraph introduction that sounds like the beginning of a high school term paper?

If you answered "Yes" to all of these questions, read this:

http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2007/01/21/ING5LNJSBF1.DTL

If you answered "No" to any of those questions, you should probably just move along.

Ready to Run

2007-03-15T12:23:00.000-04:00

It's Thursday morning, about 10 a.m.

My wife got invited to go up to the Big City this weekend. I was planning on tagging along - goofing around, hanging out with my brother who lives up there. Good times had by all.

Only sometime last week, The Wife had to cancel. Work and such. Busy, busy busy. You know how it is. I figured that meant I wasn't going anywhere either. After all, she was the reason behind the whole trip.

By Monday, I had basically given up on the whole thing. I mean, it's a 6 hour drive each way. Up on Thursday, back on Sunday. Why drive 12 hours when I've already lost the primary reason to go up there in the first place?

Plus our old car is pretty rickety. Who knows if it'll even make the trip? I should probably get some work done, anyway. You know how it is.

Then the weather turned nice. 60 degrees all week. Bright, sunny days. Clear as a bell. Nice driving weather. But still; it's a long way. It's a dumb idea. I'm not going.

I never told anyone I definitely wasn't going.

I still haven't, and it's 10:15 a.m. on Thursday. If I was going to go, I would really need to get out of here by 11 a.m. or so. Run home, get packed, get out of Dodge. Really, it's too late now. Right? Of course. Be sensible.

Honestly, though, things are pretty slow around here at the end of the week. I worked late last night, so I'm ahead of schedule. They wouldn't miss me around for two days, would they? It's not even two whole days. A day and a half, when you think about it.

That's funny. Anyway, back to work.

What else am I gonna do this weekend? All the hunting seasons are closed. The river is blown out. The lakes are still iced over. Turkey season doesn't start for a month. Not like I've got a lot else going on, right? And the wife has to work on Saturday. She's going out with her friends tonight. She probably won't even notice I'm gone. She'd probably like to have the house to herself for a change, right? I mean, that's probably what's best for her. It's like a favor, really.

10:35 a.m. I guess there's still time. Maybe I should reconsider. Look at that sunshine.

And the old car's running pretty good now. The tires almost fell off last week, but we've got that taken care of now. It would probably be good for it to get out on the road. Test out the new parts, you know? Better break them in before the weather turns cold again, don't you think? You have to break in new car parts, don't you? This is probably for the best.

How much longer will I be twenty-something with a ridiculous job where I don't have to show up on any given day? How many more weekends will come along like this? It's an opportunity, really. Time is running out. The clock is ticking! When I'm 45, I'll look back and wish I'd taken this trip! What was I thinking?! I have to leave!

And look at that sunshine!

10:43 a.m.

See you next week.

Electricmobile

2007-03-14T12:04:00.000-04:00

Within my lifetime, gasoline will cease to be the primary fuel for transportation. I'm fairly certain of this, given I'm lucky enough to avoid getting killed by a moose or a bear and thus severely limiting the duration of "within my lifetime."

Let's put a number on it. I'll wager that within 50 years, gasoline cars will have gone the way of the Stanley Steamer. Face it; there is a finite amount of oil on the planet, and we're going through it relatively quickly. As it becomes more difficult to find and dig up oil, the price will rise. When gas gets sufficiently expensive, other options will start to look a little better.

Some say we've already reached that point. Gas is $2.49 a gallon around here. That's high, but I pay it. I pay it, and I don't even think about driving less because of it. I'd pay $3 if I had to. When would I start seriously looking at alternatives? $5 per gallon? $10 per gallon?

I don't know what the number is, but we'll get there. I think that the transportation revolution will be driven not by environmental concerns, nor by the threat of global warming, but by cold, hard cash.

I like to think about what will become the next gasoline. The major players are starting to step up. Hydrogen cells. Ethanol. Better-efficiency gasoline. Electricity.

As of today, my money is on electricity. For one thing, the infrastructure is already in place; everyone has electricity. Today's plug-in electric cars run on a standard 110 household outlet. I have no idea what a hydrogen fueling station even looks like, but I've got five electric outlets right here in my office.

Electricity has very few problems, logistically speaking. We already know how to make electricity. We can always build more power plants. True, a ton of those power plants have the same environmental problems as gasoline, but remember that this revolution will be driven by dollars. If electric cars are cheaper than hydrogen and ethanol, they will win in the end.

The biggest problem I can see with electric cars is that they suck. I suppose I should say, "the technology isn't there yet," but honestly, the problem is that they suck. Check out these stats:

ZAP Xebra Sedan
(~~First~~ Fastest production electric car)

Top Speed: 40 mph
Range: 25 miles
Time to Charge: 8 hours
Cost: $10,000

Low horsepower. Doesn't do well on hills. It's tiny. It's technically classified as a freaking motorcycle. (It's only got three wheels.) Excuse me if I don't rush out to get my hands on one of these. It's kind of cool, but it's essentially an enclosed electric scooter. $8-per-gallon gasoline is looking a little better.

But the technology is changing. And as gas prices continue to rise, more companies will put more and more R&D money into this kind of thing. I was reading Popular Science today and came across this:

ZAP-X
(Joint project with Lotus Engineering)

Top Speed: 155 mph
Range: 350 miles
Horsepower: 644
Time to Charge: 10 minutes
Cost: $60,000
Cost per Charge: $3.50

That's not a nice electric car; that's a nice car, period. Plus, look at it. It's cool!

The ZAP-X isn't in production yet; I'm not even sure if they have plans for mass production. But they did build one. ZAP and Lotus brought one to an auto show in February. And 60 grand is pretty pricey, but it's not that expensive. If they can build this today for $60K, what will they be able to do in five years?

The big question is: When do electric cars stop being a neat trick and start being "the logical choice?" A slick Lotus crossover that operates at a penny per mile makes me think that day may be closer than we think.

Ross and Horses

2007-03-13T14:10:00.000-04:00

This post was sent to me by Ross so that it may be posted. I assure you, even though I am posting it, Ross is the author. What you decide to be true is your own belief.

This is in response to Jarrett's claiming that I am only a figment of
Brennan's imagination. I assure you I exist, I'm just not prolific. It's
hard to keep up with Jarrett's posts on the status of Western ecology and
the latest on a presidential election that's almost two years ahead. How am
I supposed to compete??

I actually enjoy most of Jarrett's post's, except the political ones. A
little too much information for me.

I don't know if everyone will enjoy this post, but I had an interesting
experience over the weekend that others might at least enjoy hearing. Have
you ever been thrown off a horse? Happened to me over the weekend. We've
got to start the story off right and say that the horse was blind in one
eye, and I'm not known as the world's best horseman, but I'm not too bad.
We were doing pretty well riding under the owner's (Matt and Becky)
supervision in a riding arena. I was having a great time. Unbeknownst to
me and Becky, Matt went off to a shed near the fence line to do something.
So one time around the arena as we are approaching the shed, Matt does
something that startles the horse (remember the blind eye) and he takes off
like a scalded dog. The problem was I didn't take off with him. It was
that whole inertia thing- maybe Steve can elaborate.

It was all innocent enough and the ground was pretty muddy, so it wasn't
really that bad. I think what it looked like was more of a textbook
baseball headfirst slide into home plate than just a "fall". Once I hit the
ground, I was just thankful that both feet had come out of the stirrups and
I hadn't hurt anything. Two days later, I can definitely tell where I
landed- feels like I got socked in the gut pretty good.

Oh yeah- I forgot to mention the fallout between Matt and Becky. Becky tore
into Matt like a dog on a three legged cat. Apparently, this isn't the
first time that Matt has spooked the horse of someone riding in the arena,
but it may have been his last.

A Call to Arms

2007-03-12T17:52:00.000-04:00

I think we need some new writers around here.

Not that we need to get rid of the old ones. We just need some additional ones, that's all.

My post-quality is clearly on the decline. Two thousand words about wolves? I mean, come on. And an epic treatise on John McCain? Seriously.

Brennan Jeffrey is busy getting edumacated at his West Coast hippie school. The Cases are busy cranking out kids, Mississippi style. Wasko is off doing whatever it is that he does. Ross was obviously a fictional character all along, existing solely in Brennan's warped mind.

I think we could use some new blood. Anybody else jiving with me on this?

Anybody know a couple writers we could ambush?

On Finals

2007-03-12T13:06:00.000-04:00

I just completed my last final of the quarter. I don't think I failed, but I don't think I knew everything, either. It was hard studying for this test; all I did really was read through the notes last night around 1 AM.

I don't have test anxiety. As a matter of fact, I have no anxiety for any kind of test, except maybe a blood test. I learned early on that tests don't really do anything, at all. Maybe its just my field, but to give a test in theology or religion strikes me as a ridiculous idea. In math, I could understand a test. A test is created to show that you actually have certain mathematical principles understood, and that you could apply them with specific numbers or concepts given to you. With theology and history, its all people and dates. No real concepts that are applied. To theorems that are of any practical use. Just people and dates. And let's face it, I'm going to forget every name that was affiliated with the progression of Protestantism in Latin America in the 18Th century. Now, I will remember what Protestantism was like in Latin America during, but I already knew that. I don't need to take some test to apply that knowledge or to understand it more. I just know about it.

From experience, studying for finals has been foolhardy. It started in high school, when I did nothing but study those years away when I realized that studying really got me no where. If I didn't know something by the time of the final, chances were that I wouldn't remember it later in life, and thus miss the point of the class and the final itself. So I stopped studying for finals. And you know what? My grades did better. Sometimes. And I like to think I'm a lot healthier in terms of stress.

In my opinion, the only valid test in my field of study at this point is an essay test, and even then, how much can you write on a Calvinism in the Americas from a Pentecostal perspective in two hours? Just give the students a week to do it, and hand in a paper. I find papers to be much more beneficial to my studies personally, and then I wouldn't have to hear about all my friends staying up all hours of the night studying for finals. Instead, they'll be staying up all ours of the night writing papers, and I can relate to that a little better.

PS. I hope the slideshow is fixed. Anyone have any other problems out there?

Wolves and the West II

2007-02-28T12:18:00.000-05:00

(SNOOZE-FEST ALERT: 1600 Words. Settle in; you're going to be here for awhile.)

In this post, I examine a few of the issues surrounding wolves in the Mountain West. When possible, I have used information from the U.S. Fish & Wildlife Service and the various state wildlife agencies. I feel that these wildlife management agencies represent the most reliable source of information concerning wolves.

I have not cited my sources in most cases. Shame on me. I can point the reader toward more in-depth information if the reader is interested.

-----

Wolves and the Endangered Species Act
Wolves in the West are still officially an endangered species for the time being. Many people are upset that this allows the federal government to supersede the states' rights to manage wildlife. Critics argue that wolves are in no danger of going extinct because 60,000 of them still live in Canada. They argue that even though wolves are "endangered" in a certain area, the Endangered Species Act should not apply.

Wolves will likely soon be de-listed in the West. This upsets wolf advocates because they believe the states of Idaho, Montana, and Wyoming will mismanage the populations, destroying much of the recovery work that has been done over the last decade. These three states have expressed an opinion that wolf populations are already too high and should be reduced. The states have shown interest in opening hunting seasons on wolves in order to reduce their numbers. Some pro-wolf advocates have expressed fears that the states will not pursue or prosecute people who illegally kill wolves.

It is unlikely that the state governments will completely wipe out their wolf populations. If the federal government believes that any state's wolf population is dangerously low, it will invoke the Endangered Species Act again. It is more likely that the states would attempt to reduce wolf populations to the minimum levels necessary to avoid the Endangered Species Act.

The Governor of Idaho, an outspoken wolf critic, has said that he would like for hunters to kill all but 100 wolves in Idaho. This is considered the lowest possible number which would avoid the Endangered Species Act. The Governor also expressed an interest in shooting the first wolf himself.

Wolves and Livestock
Wolves were originally exterminated in the lower 48 states because of the threat they posed to livestock. Today, wolves are still enormously unpopular among Western ranchers. Wolves will kill livestock; it cannot be avoided. In 2006, wolves in the West killed 344 sheep, 170 cattle, 8 dogs, 1 horse, 1 mule, and 2 llamas. These numbers include only "officially confirmed" wolf kills. They do not include unreported wolf kills, nor reported kills which could not be confirmed as wolf-related.

Wolves account for a very small percentage of overall livestock losses. According to a study by the U.S. Fish & Wildlife Service, predators killed 12,000 sheep in 2004 in Idaho, where wolves are most abundant. Of those deaths, only 270 were from wolves. Coyotes accounted for 7,100 deaths and domestic dogs accounted for 1,400. In addition, 10,000 sheep were lost to non-predator causes.

It is legal for people to kill wolves "in defense of life or property," which includes livestock. About 150 wolves were officially killed in defense last year. This number includes only reported and confirmed cases.

Government and private programs are in place to compensate ranchers for livestock lost to wolves.

Wolves and Wild Game
Wolves are also extraordinarily unpopular among some groups of hunters. They believe that wolves greatly reduce populations of elk and deer. With fewer animals in the woods, hunters have less success.

Wolves do reduce elk and deer herds. The Idaho Department of Fish and Game conducted a study among the Salmon Region elk herd in 2005. Again, Idaho is where wolves are most abundant. The Department concluded that wolf re-introduction reduced the Salmon Region elk herd from 28,000 animals to 25,000, a difference of 11%. The study also found that out of all elk killed in a given year, 52% came from hunters, 30% came from mountain lions, 7% came from wolves, and 7% came from malnutrition.

Perhaps more damaging from the hunter's viewpoint is the change in elk and deer behavior caused by wolves. Wolves discourage elk from congregating in large herds in open meadows. Wolves make elk and deer more wary. Elk and deer that have been hunted by wolves tend to hide in thick timber at high elevation in small groups. This likely makes it harder for human hunters to find and kill these animals.

Are Wolves Dangerous to Humans?

Statistically, no.

In 2005 a hiker in Canada was killed by wolves. This was the first confirmed human wolf kill in North America since 1900. Other unconfirmed wolf kills may have occurred during that time, but the number would be fantastically low. Wolves are usually very wary of people. They have spectacular hearing and smelling abilities, and they use them to keep their distance. Occasionally wolves will approach humans out of curiosity, especially if domestic dogs are present, but there is no evidence that wolves consider humans either "food" or "enemies." Snakes, dogs, and deer kill people every year. Wolves do not.

Who Needs Wolves, Anyway?
From a purely ecological standpoint, wolves are a good wildlife management tool. Elk and deer populations are dangerously high in many places across the country. Wolves were originally introduced in Yellowstone in part to help control the runaway elk population, as it is illegal to hunt in a National Park.

When elk and deer herds become too large, the population suffers as a whole. Disease and malnutrition become more prevalent. The herd becomes more susceptible to large population swings. An out-of-control population of large grazing animals can lead to destruction of habitat and food shortages.

Population control is now accomplished primarily through public hunting. When this is not enough, state agencies will often hire sharpshooters or helicopter teams to kill additional animals. In many areas elk and deer herds are out of control because both hunting and government-kills are unacceptable or impossible. One example is Rocky Mountain National Park, where hunting is illegal and a high density of tourists makes government killing both distasteful and unpopular.

Wolves are much cheaper than hiring sharpshooters.

Wolves efficiently cull the herd. Wolves generally kill animals which are old, young, or weak. Hunters generally focus on the biggest, strongest, and most fit. From a purely biological standpoint, the wolves' outlook is more favorable.

On a broader scale, the presence of large carnivores benefits the environment in many ways. When a major species is completely removed from it's native ecosystem, the implications are wide-reaching but complicated. It's hard to tease out the precise chain of cause and effect.

The natural world is fantastically complex; we still don't understand many aspects of it. However, most biologists will agree that having more native species is good while having fewer native species is bad.

Many people believe wolves are important for reasons other than wildlife management and biology. Some like wolves for aesthetics; they're nice to have around. Some believe that because wolves once inhabited this country, they have a right to live here. Some believe that every species is valuable in and of itself; therefore we should do whatever we can to keep them around.

Finally, many people argue that wolves encourage tourism. A University of Montana study recently found that wolf re-introduction in Yellowstone has directly generated an additional $35 million in tourist revenue.

Comments
Wolves are fascinating to me, personally, but still I find that I don't feel particularly strongly either for or against re-introduction. As a hunter, I tend to focus on the ecological and environmental impacts. For good or ill, I tend to view wolves as a wildlife management tool. If re-introduction helps the herd, then do it. If it doesn't, then don't. Admittedly, this is a very narrow perspective.

I would advise pro-wolf advocates to stick closely to the topics of ecology, ranching, and tourism when engaging this debate. Arguing for wolves for the sake of aesthetics is dangerous. Introducing wildlife because it's nice to look at is a poor precedent. I think it would be pretty cool to have some tigers around here, but introducing them would likely be a disaster.

Arguing for wolves because "they belong here" or because "they have a right to exist" is a powerful idea, but it makes for a weak point of debate. If an opponent has made up their mind that no such right exists, it is very difficult to persuade them otherwise. The "wolves belong here" argument is largely self-evident; people either believe it or they don't.

I'll close with a judgment call:

The evidence advanced by anti-wolf advocates is weak. It is largely anecdotal, based on something that happened to a friend or a neighbor because of wolves. I've heard many stories about wolves killing a whole flock of sheep or eating the family dog, but I've never seen even an attempt to make the case that wolves cause economic hardship on a broad scale, especially when compared to other causes of livestock loss. I've heard stories of wolves driving all the elk out of a favorite hunting spot, but I've never seen a single scientific study suggesting that wolves damage the overall health of an elk or deer herd.

Studies and analyses to the contrary in both cases are abundant.

The strongest argument against wolves is that they are inconvenient, particularly to ranchers and some hunters. This is a valid complaint and shouldn't be dismissed out of hand. However, when one side presents the wolf as ecologically and economically beneficent, and the other side counters that they're inconvenient for some people, I can't help lean in favor of the wolf.

That is my opinion, based on the evidence I've seen. I'll leave the rest for the reader to decide.

Wolves and the West

2007-02-27T11:51:00.000-05:00

It may surprise some readers from other parts of the country, but in the Mountain West, wolves are a political flashpoint. Many Westerners argue just as fiercely about wolves as they do about stem cell research and Iraq. In states where wolves have been re-introduced, or potentially could be re-introduced, wolves represent a major political issue.

I'd like to present two seperate posts about wolves in the West. Today I'll summarize how wolf populations have changed as a result of human activity. In a later post, I'll discuss a few of the major issues surrounding wolves and wolf re-introduction in the West.

For the purpose of this series, I'm going to focus on Gray Wolves (Canis lupus.) America is also home to Red Wolves (Canis rufus,) which live only in the Eastern half of the country. The reader may also be familiar with the term "Timber Wolf," which is simply another name for the Grey Wolf. From this point on, I will use "wolves" to mean only "Grey wolves."

-----

In America, Gray wolves once ranged from from the Atlantic to the Pacific and from Mexico to Canada where habitat was suitable. Wolves were not popular with European settlers. They were seen as a threat to both livestock and wild game. They were trapped, hunted, and poisoned, all of which was endorsed by the U.S. Government at the time. The Endangered Species Act of 1973 protected grey wolves, but by that time they had been eliminated from the lower 48 states, except for a few hundred animals living near the Canadian border in Minnesota.

Starting in 1995, wolves were re-introduced in the Mountain West. Re-introduction was focused mainly in two areas: Yellowstone National Park and Central Idaho. The re-introduced populations in these areas have now grown to over 1,000 animals in Wyoming, Montana, and Idaho.

Wolf populations have recovered in Minnesota, Michigan, and Wisconsin naturally. As wolves migrated down from Canada, the wolf population in these three states has grown to about 4,000 animals.

Re-introduction efforts are underway in Arizona, focusing on the Mexican grey wolf "subspecies." About 60 Mexican grey wolves now live in the wild.

The Canadian wolf population is still fantastically large, including approximately 60,000 animals. Alaska also has a large population of wolves, about 6,000 animals. Alaska and Canada contain huge swaths of remote, uninhabited land where wolves thrive. Wolf populations in Alaska and Canada have never been seriously threatened.

Wolves are not considered "Endangered" in Alaska, Minnesota, Michigan, or Wisconsin. Essentially this means that wolves are not protected by the Endangered Species Act. They are managed by the states, rather than by the federal government. Wolves are likewise not considered "Endangered" in Canada.

Wolves in the Yellowstone area and in central Idaho are still listed as "Endangered," and they are managed by the federal government. This will likely change soon. The wolf re-introduction effort in these areas has greatly exceeded the population goals set by the federal government. Wolves around Yellowstone and central Idaho will probably be "de-listed" soon, and they will be managed by the respective states.

Wolf re-introduction has been proposed in many other states ranging from Washington to Colorado to Maine. At this time, I am unaware of any other re-introduction efforts which are formally underway.

Wolves in the wild travel enormous distances. It is possible that wolves will naturally extend their range into new states, like they have done in the Upper Midwest. A lone wolf was recently sighted in Northern Colorado. It was likely born in the Yellowstone area, about 400 miles away.

To the best of my knowledge, this is the state of the Grey Wolf in America today.

Lawless

2007-02-23T12:14:00.000-05:00

Court: Detainees Can't Challenge Cases

I realize it's quickly becoming apparent that I'm obsessed with the Guantanamo Problem, but this is an interesting story, and it won't take long, I swear.

A recent decision by a U.S. Appeals Court has decided that the Guantanamo prisoners should not be given access to the U.S. civil court system, but rather should remain solely in the custody of the military, where they shall be tried and sentenced by the military. Two key aspects of the decision:

Now, detainees must prove to three-officer military panels that they don't pose a terror threat.

They also said that in the case of Sharaf al-Sanani, a Yemeni being held at Guantanamo, the government was no longer obligated to explain why he was being detained.

The Guantanamo prisoners must now prove to the military that they are not guilty, rather than the other way around. And the government is under no obligation to explain why they are being detained in the first place. "How does that work?" you ask, "What about the Constitution?" I'll let the court explain:

Randolph, writing for the majority, said the new commissions act clearly blocked court access and was constitutional because a "foreign entity without property or presence in this country has no constitutional rights."

The court has decided that the U.S. Constitution applies only to U.S. citizens. Or at least I think that's what they have decided. That language about "property or presence" has me confused. Surely the court wouldn't divine a man's rights based on whether he had a Ford Festiva parked in San Diego. Right?

In any case, it's clear that the Constitution doesn't apply to everybody. There is some gray area concerning U.S.-resident non-citizens, and some even grayer area about a non-resident, non-citizen who owns a donkey in Wyoming, but the Constitution definitely doesn't apply to donkey-less, non-resident, non-citizens.

The Constitution is only for U.S. citizens and the Geneva Conventions are only for prisoners of war. The unauthorized Iraq invasion in 2003 showed that we will abide by the U.N. regulations only when they suit us. As I understand it, the U.S. government is bound by no laws when it operates on foreign soil in "non-war time". In Iraq, in Afghanistan, in Somalia, in Iran, in Yemen, in Cuba, and in Israel, the United States Government is a lawless entity, answering to no one except the opinion polls back home.

Given the general nature of all governments, not just our own, this strikes me as a very poor idea.

On Updates

2007-02-22T16:57:00.000-05:00

I added some links, and a photo slide show. I'm trying to take a picture a day for an entire year, and what you see in the show is the month of January. It may be a bit buggy, especially when it comes to resizing the originals. Let me know what you people out there see.

I added links to the works of Steve Case and Rob Kring, both stellar individuals. Enjoy, and let me know how we can better serve you!

On Classes

2007-02-21T23:55:00.000-05:00

Since I've been at Fuller, I've refrained from posting anything about my classes. Mostly because I understand them to be quite boring to anyone not incredibly invested in theology, but this I have to share. This is just too cool.

I'm in the process of registering for my classes next quarter. Since being here, and really all my time in school, my life has reliably consisted of a steady diet, lots of reading, and lots of writing. Not much else.

Now, there's a class I'm registered to take entitled Luke and the American Road Movie. It is a graduate class, worth seminary credit. It will contribute to my master's degree, and therefore help me pursue a career in hospital chaplaincy. In it, we watch movies. A lot of movies.

For those of you in the real world, working real jobs, this may not be a big deal to you. Heck, you can watch movies whenever you want. But think back to a time when you were in school, and the only thing that mattered was getting good grades. Life revolved around grades. Each piece of work you did either raised or lowered your grade. For years, your blood, sweat, and tears were all invested in your grades. Your very salary in some futuristic existence depended on how well you wrote that paper, or how well you understood a piece of literature, or how much time you spent in class. Movies, at best, were a distraction; a brief lapse into recreation during a time when more serious matters were at hand. Now think if your grades, your livelihood, your salary depended on watching movies like Thelma and Louise or O Brother, Where Art Thou?

I'm very excited.

The way I understand it, the course is not a lot of traditional work. We only read about two books with any diligence, and with several others as reference, but the bulk of the material comes from watching ten movies that surround the Lukian ideas of "journey" and "reconciliation." They give ten rather fine flicks, but we can also choose which ones we care to watch, as long as it fulfills some rather lax requirements.

Think of it, a Friday night with your significant other, the two of you curled up on the couch, sharing a bowl of popcorn, watching the hilarious antics of Steve Martin in The Jerk, and all the while you're actually doing homework.

I love grad school.

Shameless Plug

2007-02-18T10:11:00.000-05:00

I've once again begun posting on my long-defunct blog. I plan (hope) to update it relatively regularly. A friend and I took a road trip out to the Delta back before classes began, and right now I'm in the midst of posting a series of some of the photographs we took. This is my shameless plug to check it out: http://idealheroicworld.blogspot.com/.