Claire sneaked into the workshop as soft as her tip toes could carry her. She saw the warm orange glow of candlelight just beyond the shadow of her grandfather. He was hunched over his workbench, toiling furiously as his hands turned tools and parts into some new creation. The bits of metal and wire seemed to be flowing from his palms like breath from lungs. Creeping closer, Claire grasped his sides with her small child hands and squeezed. The unsuspecting victim leapt in his seat with a yelp, and piles of screws, bobbins, and tools tumbled to the floor.
"Claire! How dare you scare an old man like that! You might have broken something!" He snipped the pliers in his hands at her nose. Claire giggled and jumped backwards holding her face as if there was a chance that her grandfather plucked her nose clean off.
"But I hadn’t expected to see you for three more days!" he said, wrapping his arms around her, "Why are you here so early, my beloved girl?"
"Mom and dad dropped me off early," she said, looking coy with those almond eyes, "You aren't mad, are you?"
"Of course not, just startled is all." He reached down and scooped her into his lap as if she were weightless. "I have a surprise for you!"
Claire's face lit up in anticipation. "I love surprises!"
"As any eight-year old should!" he laughed, "Here, see this." He turned his stool to show Claire what he was working on. In the middle of the debris of pliers, lenses, wires, brass, and wood sat what looked to be a small typewriter. It had golden brass inlaid keys with lettering, dark wooden paneling, and a small spindle of paper set right above the keys. Behind the keys and paper, the box was wide open and Claire could see inside complex wiring and electronics that she had never seen before. A small lens protruded above the mechanics but the machine was clearly unfinished. Beside the machine was a wooden box just slightly larger than the machine. It had carvings in the sides and lid of birds in flight, though it too appeared unfinished.
"What is it?" Claire asked.
"This is a very special invention," her grandfather said, "My hope is that this box will help people when they need it most."
"But what does it do?" she asked, poking at the brass keys with her fingers.
"Well, you put a small bit of blood in this thing here..." he reached around a grasped a glass vial and placed at the side of the box, "... and then the machine reads your blood and tells you how you will die."
Claire laughed, "No one wants to know that, grandpa!"
He nodded but with gleam in his eyes behind his round spectacles. "Death is something that most people don't want to talk about, I agree. But I believe it's something we need to talk about, nonetheless. This machine starts the conversation only by telling you how it will happen."
"Do you mean if you're sick?"
"Perhaps, but any other way, as well. If it is an accident, or a sickness, or the result of a foul scheme, this box will tell you."
"How does it do that?"
"It reads your blood. Blood always tells the truth."
"But how does blood know? Blood is just blood."
Her grandfather gave her a small hug and heaved a sigh, "Many people have forgotten some of the deepest and best ideas in life, Claire. Ideas like 'There is nothing new under the sun' or 'Life is one great story that connects us all.' And life is more simple than what first meets the eye. We are all born, we all breathe, grow, and we all die. The experience is unique to each person but we all share in joy, pain, and grief in some way. And deep inside, it's our blood that tells our story."
"How?"
"That's another thing people have forgotten. Our soul is in our blood. Every little cell tells your story from beginning to end, from when you're born and how you grow up, to how you die. The smallest part of ourselves speaks with every other cell and every other person, whispering our beginnings and ends, but it speaks so quietly that we often do not hear them. This box helps make the telling of our stories just a little louder."
Claire became quiet. She was busy thinking whether it would be a good or bad thing to know how she would die or to talk with her blood. "Grandpa, isn't it scary to die?"
"For some it is," he answered truthfully, for he always tried to tell the truth, "There' a lot that we cannot know about what it means to die but we know it hurts a lot when we lose someone we love. And so I wondered, too, what could I do to make the telling of the ends of our stories a little easier. And then I had a fabulous idea! Do you want to hear it?"
Claire nodded once, up and down.
"I thought of you! I thought of how much easier it would be to get such news from someone I loved and trusted. This is part of the secret," he pointed at the lens at the open end of the machine, "From this little lens, when you choose to use the machine, the person most important to you will emerge and tell you how you're going to die. It helps to hear these things from someone you love. Sometimes they can teach us what it means to die well."
"But how does it know who to show?"
"Your blood knows. You can feel it deep down when you truly love someone. That's because it's in your blood. Even when they're far away and you haven't seen them for a very long time, you can sometimes feel them speaking to you. That's your blood reminding you that you are loved."
He turned the stool away from the workbench and set Claire back down on solid ground, "But, that's enough for now. Come on. Let's go get dinner started. How does liver and onions sound?"
Claire wrinkled her nose, crossed her arms and stomped her foot hard. "Well," he exclaimed, "If not liver and onions then we'll have to have ice cream! That's all the food I have!"
Claire smiled and grabbed his hand, calloused hard from years of crafting. They walked out to the house, "I always feel better when you're around, grandpa. I feel it deep down. Is that my blood talking to me?"
"I think it is, and my blood says the same thing." He smiled wide until white teeth peeked through his thick beard. Patting her head they walked into the moonlit night towards a dinner of ice cream.
#
Claire didn't recognize where she was. The walls and floors were white and everyone was wearing white clothing. All the brightness reminded her of her grandfather; white was his favorite color. Claire would have done anything to see her grandfather at that moment. She was tired, cold, and in pain. All the strangers around her kept saying how brave she was but she didn't want to be brave. She only wanted to go home.
"I'm afraid its cancer." One of the men in white said. "A rare form of leukemia. There are some treatments, some things we could try to fight it with, but I'm not going to lie to you. Not much is known about it and there's no guarantee anything will work and it will be very hard to fight."
"How long?" Claire's father asked. It looked to Claire that he was angry so she was too scared to say anything.
"It’s hard to say. Everything points to a slow growth, but if it’s metastasized to the lymph nodes then I'm afraid I can only put the survival rate at 10%. At the current rate of growth with chemotherapy and treatments, maybe two or three years at most."
Her father sighed and her mother began to cry. Claire was feeling scared and she didn't understand what was happening. There had been lots of needles and cold metal surfaces with strange lights and beeps. She knew she was sick but she didn't feel too bad. Surely it wasn't anything a bowl of soup and an afternoon of blankets and books couldn't fix.
"I know it’s difficult to hear but some decisions need to be made soon."
"Do everything you can." Her father said sternly.
"I just want you to understand. This can be a hard and painful process, and with the survival rate being what it is there are other options that can improve quality of life..."
"No." Her father almost screamed, "Do everything you can."
"Very well." The man in white jotted down some notes and nodded.
The three adults looked to Claire in the hospital bed. Her parents crouched beside her while the man in white smiled and squeezed her hand. He was kind, but there was something not right about that smile to Claire. It wasn't warm, like the way her grandpa used to smile at her. When grandpa smiled she felt it deep down, "in her blood" as he used to say. The stranger's smile was more like a mask, distant and fake. Surfacey. Not deep at all.
"I don't like it here. I want to go home."
"Honey, you're going to have to stay here for a while." Her mother said as she knelt next to her. She wiped Claire's cheeks that were dry as tears poured down her own. Claire didn't understand why she was crying but she knew something serious was happening.
"Mom, what is it?"
A nurse came up and poked Claire's arm with a long needle. The pain shot up to her shoulder but she only watched as the blood traveled through her veins into the clear plastic tube.
"You're very sick, dear." It was all her mother could say before sobbing.
"Grandpa says our blood speaks to us." Claire said as she watched the blood be taken from her.
"Your grandfather said a lot of strange things, Claire," her father said.
"Is grandpa coming to my eleventh birthday?"
"No, dear, grandpa isn't coming to any more of your birthdays. We talked about this. Grandpa's gone."
For some reason, Claire kept forgetting what had happened. It was only last week when her father woke her in the early hours of the morning. She could hear her mother crying in the other room. Her father spoke her name loud enough to wake her. When she rubbed the sleep from her eyes she saw him sitting on the bed next to her, his face blank showing no emotion.
"I have to go, Claire." He began, "Last night, grandpa had an accident. I'm afraid he's gone, Claire. Grandpa's gone."
He spoke in a very matter-of-fact tone with lots of nods and eye contact. But he never hugged her.
Claire felt numb. "What happened?"
"He was walking home from a lecture at the college late last night. His neighbor was outside on the roof doing some stargazing when he took a misstep and knocked a telescope over the side. It hit your grandfather as he was walking underneath."
And that was it. That's how grandpa died. It wasn't until she was in that hospital room with all of the white and strangers and big words like 'leukemia' and 'chemotherapy' that she began to feel like he was really gone. Tears began to stream down her face.
The man in white clipped something to his notepad and turned to the father. "For what it's worth, I'm sorry. I'll do everything I can."
"I know. And thank you, doctor. What would be the plan from here?"
"Well, we'll keep her overnight for more tests, start her on chemo every six weeks..."
Claire could hear the voices trailing off but could feel something else growing inside her. She began to feel fearful, like she was standing before a great mouth that was yawning to swallow her whole. There came a ringing in her ears that wouldn't stop, and the sounds of voices became less and less until she could her nothing else around her. She could only think about how much she missed her grandfather and the hurt of his death clamored over all of her senses. Claire closed her eyes and went inward. No one around her seemed to see her, so she tried to see herself. She could feel, deep down in her blood, a cavernous yearning and pain. She never felt anything so terrible and she was scared she would become lost in the interior world of grief. It was then that another pain shot up her arm and suddenly she was back in the room with white walls. A nurse had put in a small needle that was connected to a large bag holding a clear liquid. Claire's arm ached as she felt the cold juice run into her veins.
"So you've finally woken up." She said, "You were asleep for quite a while!"
Claire didn't feel she had slept at all but she noticed she was in a different room. Claire looked around and saw that her parents and the man in white had gone. The nurse took notice of her searching eyes.
"Your parents stepped out for some dinner but they'll be back soon." She ripped off her blue gloves with a snap. "They left that letter for you. They said it’s an early birthday present."
Beside the bed was an envelope with two words scribbled on the outside, 'From Grandpa.' When she lifted it Claire noticed it felt heavy; there seemed to be more than just a letter inside. She tore open the top and gently pulled at the parchment with trembling fingers. She read the words on the page:
Dearest Claire,
First and foremost, I'm sorry I will not be there for your eleventh birthday. It seems that this world has a different plan for me.
I had hoped to see you grow into a beautiful woman, to watch as you learned and loved and walked the path of discovering yourself. There's so much I had hoped to teach you but I'm afraid I must leave your life a bit early. I used my greatest invention today and it told me how I would die, and judging from the words I had surmised that I would be dying soon. But the news came from the lips of a face that looked like yours, so it wasn't terrible. To be sure, I've lead a wonderful and joyous life and it was made better because of your love. Even though I may be dying in body, know that my blood is always a part of yours and that my love is just as close to you as your next breath of air.
One day, when you're ready, use this key to access my machine. Only use it if you truly want to know how your story will end. Remember, it MUST give a prediction when used and you may not like what you hear even though the news will come from someone you love. But I've taught you all I can with the time I had and someone who lives well has nothing to fear of death. So it is with me. Though I must admit I am curious to learn how it will actually happen... I left you my prediction so you too can see how odd it was.
I will cherish you always and if you ever call out my name, I promise I will hear you.
Remember, we are all connected.
Your Grandpa
Inside the envelope was a small brass key and a tiny slip of paper that read NEXT FULL MOON.
Claire cried. Even though she knew her grandfather meant every word of that letter, she didn't feel loved or heard. He was gone. In those moments after reading the letter Claire never felt more alone in her life. It felt as though her very blood was shaking in anguish. She retreated inward again, trying to make herself feel as she did when her grandfather would see her and smile. She tried to remember his face with the round spectacles, funny wrinkles, and gray beard. She tried to hear his voice and feel his calloused hands patting her head. But she couldn't. It was almost like she forgot. No, it was more like her soul forgot, her blood forgot. In the darkness of herself, in that loneliness, Claire didn't know what to do. She felt the world around her begin to disappear in despair when a stab in her arm brought her back to the present moment. She must have been shaking; the small needle in her arm had gotten loose and had come out with a jerk at her vein. It was dripping slowly onto the floor. She lifted to look at the needle closer and she saw a few small drops of blood on the tip. The pain inside was too much to bear, yet the pain in her body and underneath her skin would bring her back. A sharp stab saved her from the sadness. For Claire, there was nothing worse than the thought of never seeing her grandfather again. She took the needle, bit her lip, and stabbed it back into place.
That time the pain felt better.
#
"Claire? Where are you?" Her father's voice was muffled through the wood and insulation, like a voice that whispered in her head.
Claire was hiding. She was doing a lot of hiding the past few weeks and this time she chose the attic as her secret place. She liked the attic because her parents never thought she could get up there and no one ever found her. It was dark and musty and smelled of rotting wood, but at least she could be alone. She was in the dark and had nothing with her but a Swiss Army knife and an old yellow flashlight with a burning-out bulb. She hit it once to get it shining again.
She held the small Swiss Army knife that had been a present from her father for her fourteenth birthday. Its blade was open and wet. Claire had made a small fresh cut just above the crease of her arm. The scars on her skin from countless IVs and surgical procedures mixed with the scars of some of her personal incisions. Some were made by doctors. Some were made by her. She poked at the newest line with her pinky. The muscle beneath responded and surged with a new mound of blood. The pain was too dull to notice anymore but it kept her out of her head still. Claire watched as a small drop of red weaved and rivered its way between the hairs of her arm down to her elbow. She was comforted by the sight of her own blood. It helped her to remember that she was still alive even if she didn't want to be, and a part of her still believed that her grandfather was in that red liquid somewhere. Over the course of the last three years she had lost weight, any sense of dignity, and almost all of her hair three times. She knew it would never grow back to flow past her shoulders again.
She was still feeling a little sick from the chemotherapy the day before. Her cancer had slowed its growth but her body was exhausted. She was scheduled for another visit later in the day. That's what she was hiding from. She hated the hospital. Nothing but machines and needles and people who look at you but never saw you. Some days Claire was strong and she could handle it but today wasn't one of those days. She toyed with the small, brass key that hung from her neck when there came a distinct sound.
*click*
Claire jumped. The sound came from a dark corner of the attic but she wasn't sure from where. Did her parents finally discover her favorite hiding spot?
*click*
She jumped again. It was a short sound, but clear. She shined the flashlight toward the corner and saw a stack of boxes covered by a dark green blanket.
*click*
Claire pulled at the blanket with a swift tug. The sound was coming from a small box in the middle of the stack. Claire grabbed the box and pulled it out. It was heavy with an ornate lid carved depicting birds spreading their wings and a small keyhole on the front. She slowly placed it on the wooden floor before her and shined the flashlight on it. The light flickered and warmed the decorated lid so that the carved birds appeared to be flying off the paneling. That's when she knew what this box contained.
*click*
Hands trembling, Claire took the key from her neck and pushed it into the keyhole. She turned it clockwise and the lock gave way with a mechanical shift. She slowly opened the lid to look inside.
*click*
It was the machine from years ago, the one her grandfather had made, the one that could tell you how you would die. Claire remembered the typewriter look, the brass accents, the deep wood paneling, but the machine looked complete. The glass vial rested on the side awaiting a sample of blood and the paper spindle was slowly turning.
*click*
The paper jerked in the other direction as if it were catching on some internal mechanism. Claire slowly removed the paper to find a piece was caught on the turning gear. Had this machine been on all this time? Her grandfather had been dead for years. How was it still functioning?
The clicking ceased. Claire removed the machine from its ornate box and placed it squarely on the attic floor. The light of the flashlight danced across the brass and varnished wood. The machine looked pristine and newly polished. It had an old-fashioned look, but she knew that the mechanics inside were as advanced as technology could get in their time, perhaps even more so. Despite what everyone believed, Claire knew her grandfather was a genius. She smiled remembering his odd sense of style; mixing the old and new.
There were small plaques of gold adorning the sides and face of the machine. Claire read on the left, "Always tell the truth" and on the right "Everything is connected." These were common sayings of her grandfather but the message on the front was the most enigmatic, "Die well."
"I've wanted to," Claire said to herself upon reading the plaque, "Life's been too hard to live since you've gone."
Just then, Claire remembered what her grandfather told her about the machine. It let someone find out how they would die but from the mouth of the person you loved most! She also remembered the words of his letter that said if she were to use the machine, she would have to hear how she would die. She knew it would be her grandfather who would said those words. She knew it in her blood. But did she want to know how she would die? The question nibbled at her mind for a long time. There was still some small hope that she could beat the cancer but Claire was tired of hoping. She wanted to see her grandfather again, to feel his love deep in her blood again, but she was afraid that she forgot how to feel. Her blood had stopped talking a long time ago, ever since he died. She imagined that darkness she encountered when she went inward had killed the voice of her blood somehow. She decided she didn’t care. Claire believed she would be dead in a year from the leukemia and chemo. She felt herself getting worse and worse each week, and to her it was only a matter of time.
There was nothing to lose and so the knowledge of how she would die became no great sacrifice. She took the vial from its brass rigging and held it in her right hand and grabbed the small Swiss Army blade on the floor with her left. She remade the wound above her right elbow and fresh blood flowed. Claire relished the pain, the feeling of something for just a moment and with hands trembling she began to catch the blood in the glass vial.
Claire didn't know how much blood was needed, and so she filled it almost to the top. She screwed the glass vial back into its brass rigging, turning it upright, and waited. She didn't know what to do next. There was no button to turn the machine on, it seemed; just the buttons of letters and numbers. But after a few moments there was a sound of a quiet vacuum and the blood emptied from the vial. It flowed through small glass tubing that protruded in separate places from the wood paneling. The paper spindle began to shake and spin and words were typed all on their own:
PLEASE ENTER YOUR FULL NAME:
Claire carefully entered the requested information, using two quivering fingers to peck out her moniker and making sure she made no mistake.
CLAIRE ANNE PETERSON
The machine whirred and buzzed, the paper fed then responded with a new typed message:
HELLO, CLAIRE. I WILL NOW BEGIN TRANSCRIBING YOUR DNA. PLEASE WAIT...
Claire waited. And waited. Nothing. "Maybe it’s broken," she thought to herself. But the machine began typing slowly in front of her.
AGTCGACTGAGAGAAGTCCTCTAGTCTCGACTTCAGA
UACUGCCUAGUCGGCGUUCGCCUUAACCGCUGUAUU
Letters began to flood onto the paper. Letter after letter after letter until the machine was typing so fast that they became a blur. Millions of letters must have been typed, and it seemed there was no end to the ink and paper. Several minutes of this whizzing transcription past when there was a sudden stop to the paper spindle.
DNA TRANSCRIPTION COMPLETE.
PERSONAL DEATH PREDICTION VERIFIED.
DEATH PREDICTION ADVOCATE SELECTION COMPLETE.
FACIAL AND PERSONALITY CONSTRUCTION IN PROCESS
PLEASE WAIT...
For what felt like an eternity, there was complete silence. Claire didn't even notice when the flashlight sputtered out. She was there in the darkness and she began to go inward, fingering the path of blood that was on her right arm. A low click and hum came from the machine as a lens rose out of the top and began emitting a soft blue light. Slowly, small shapes of squares and lines began to grow from the surface of the lens. Claire watched as a face began to take shape before her, much larger than real life. At first, it was just a plain blue face, but lines and dots began to mark the spots of wrinkles, hair, and spectacles that created the face of her grandfather. As if by magic, he was there. Claire recognized every wrinkle and hair, and the face looked down at her with those kind, twinkling eyes. It was the moment she had waited for.
The face spoke, “Hello, Claire.”
#
Claire stared at the fuzzy, pale blue face not knowing what to say. She trembled as a single tear ran down her cheek.
"Grandpa?" Claire said.
The wizened old face blinked and looked down at her, smiling kindly. The face was a deep blue with horizontal static lines running its length with periodic waves that distorted the image. Claire could see each point of the face she missed so much: the long beard and bald head, the bushy eyebrows sticking out from behind the round spectacles, the small mouth that was buried underneath a thick moustache, and his eyes; those kind, gentle loving eyes that she had searched for ever since he died.
She reached out to touch his beard, his wrinkles, his round spectacles but all she could grasp was air. The face of blue lines would only shake and adjust to her fingers, rematerializing after they left the projection of the machine.
"Hello, Claire." The face said again, with all the love and kindness a grandfather could have.
"Grandpa," Claire said between fits of tears, "I've wanted to see you for so long."
"It’s alright now. I'm here."
Claire could no longer contain her grief. She cried there in the attic, kneeling, her knees to her forehead hiding her face. She couldn't stop from shuddering. There were moments when she couldn't breathe but the face from the machine only looked on, the pale blue glow illuminating the room.
She took a deep breath while the tears subsided and her body stopped convulsing. "Why did you leave, grandpa? Why did you go when I needed you most? If you knew when you were supposed to die, why didn’t you try to stop it?"
"I'm sorry, my love." The face said, "I would have stayed forever if it meant to save you pain. But I had no say in the matter. I could not have stopped my death any more than I could stop the rising of the sun.”
"I need you here with me." She cried again.
"I am here with you, my beloved child. I am always with you."
"It’s not the same," she protested, "I need to see you here, to feel you here. I've needed to hold you for so many years but you weren't there."
"I was there, just not in the same way as before. I've watched every tear you've cried, heard every scream you've yelled, felt every cut you've made."
Claire instinctively covered her arms. She told no one about her cutting and there was no one yet to question the marks. She found herself embarrassed and ashamed.
"You do not need to hide from me, child. I know the loneliness you've felt. The yearning you've had for it all to end."
"I just want to die..."
"I know. It's been so hard for you. I wish I can take your pain away but it is yours to bear."
Claire sniffed and avoided his eyes. "So am I going to die?"
The blue face stared at her. It did not answer right away and Claire was beginning to think it was broken somehow.
Just before the silence became unbearable, the face spoke, "Everyone dies someday, Claire. What matters is not how or when we die, but whether or not we die well."
"And how does someone die well?" Claire asked.
"By living well," the face replied, "Sharing love, confronting fear, making peace, helping others... these ideas are simple but they make living and dying all the more easier."
Claire shook her head, "It’s too much. It’s all too much... I can't stand it anymore..."
The face said nothing. Claire began to cry again.
"This is your story," the face said, "No one can tell it but you. While the tragedies that happen to us may or may not be set in stone we still have the choice to either be defeated by them or to grow from them."
"And what if we can't grow?" Claire asked, "What if we just die?"
"Death is only another opportunity to grow, dear child. I should know," the face smiled, "With each moment I tried to leave this world with a little more love than when I found it. Even to my dying breath I thought about how grateful I was to have you in my life."
Claire wept again. She felt as though all she was were tears now. “I think I just forget how to live, ever since you died.”
"I know, Claire," the face paused, "My time is almost up. How do you believe you will die?"
Claire wiped away her tears, "Cancer." It had become a word she spoke too often, a word she had become too familiar with.
“Then that is how you will die, Claire.” The face spoke with a sigh, “If you give up, if you choose to be defined by your disease then that is what will claim your life. In fact, if that is your choice, then it already has.”
“I don’t care anymore.”
“Tell the truth, Claire. I know you better than that.”
"Why does it even matter?"
The face grew stern, "It is the only thing that matters. You have the power to choose what your life means. Search deep down, Claire. What is your blood telling you?"
Claire closed her eyes and tried hear herself. Despite her fear, she went inward and confronted the terrible pain that she had been running from for years. But instead of it swallowing her whole, it whispered to her. It was her inner voice, her blood. What she had thought she had lost and forgotten was there all along, alone in the darkness of her deepest self. Instead of running, she chose to listen. "My blood... My blood wants to live."
"Good. I’m glad you can finally hear it again." The face smiled at her.
It was then that Claire didn't feel like crying anymore, "Thank you, grandpa."
"You're welcome, dear girl."
Claire stood and rubbed her arms. The blood had dried and her scars were visible, but she didn't feel like hiding them anymore.
"There's one more thing, Claire," the blue face said.
"What is it?"
"I have to give my prediction."
"But I thought cancer was..."
"That is what you predicted. Now I must give you mine."
Claire held her breath. The blood flood through the glass vacuum of the machine and the blue face looked at her with piercing eyes. Just moments before, Claire didn't care if she lived to the end of that conversation, but she could not deny, deep down, deep in her blood was a small glimmer of hope at life beyond cancer.
The face was silent and thoughtful but the paper on the machine was busy spinning away. It typed a single line of text and cut the sliver loose. It fell to the floor before Claire’s feet.
She read: 80th BIRTHDAY CAKE
“Well, isn’t that curious? Just as bewildering as my own prediction…”
Claire smiled for the first time since her grandfather died. She felt that old feeling of warmth deep in her blood. Her mind was racing past all the people she might know who were close to becoming 80 years old but she stopped herself and began laughing.
"I suppose it doesn't really matter." She said.
The face laughed too, "No, it doesn't. What matters is how you share your love with the time you have. Remember that, Claire." The blue lines that made the face were beginning to wave and static. He was fading away.
"What's it like to die, grandpa?” She asked before he was gone.
"It isn't as bad as most people fear. And there are so many wonders to see after!" The face fizzled down to bits of dots and lines. The bright blue glow grew dimmer and dimmer until there was nothing left.
"Goodbye, grandpa."
Claire grabbed the flashlight and hit it once. The light flickered on and Claire crawled down the attic steps, leaving behind the machine and the Swiss Army knife but taking hope with her.
0 comments:
Post a Comment