Thursday, December 08, 2011

Next Full Moon

Claire sneaked into the workshop as soft as her tip toes could carry her. She saw the warm orange glow of candlelight just beyond the shadow of her grandfather. He was hunched over his workbench, toiling furiously as his hands turned tools and parts into some new creation. The bits of metal and wire seemed to be flowing from his palms like breath from lungs. Creeping closer, Claire grasped his sides with her small child hands and squeezed. The unsuspecting victim leapt in his seat with a yelp, and piles of screws, bobbins, and tools tumbled to the floor.

"Claire! How dare you scare an old man like that! You might have broken something!" He snipped the pliers in his hands at her nose. Claire giggled and jumped backwards holding her face as if there was a chance that her grandfather plucked her nose clean off.

"But I hadn’t expected to see you for three more days!" he said, wrapping his arms around her, "Why are you here so early, my beloved girl?"

"Mom and dad dropped me off early," she said, looking coy with those almond eyes, "You aren't mad, are you?"

"Of course not, just startled is all." He reached down and scooped her into his lap as if she were weightless. "I have a surprise for you!"

Claire's face lit up in anticipation. "I love surprises!"

"As any eight-year old should!" he laughed, "Here, see this." He turned his stool to show Claire what he was working on. In the middle of the debris of pliers, lenses, wires, brass, and wood sat what looked to be a small typewriter. It had golden brass inlaid keys with lettering, dark wooden paneling, and a small spindle of paper set right above the keys. Behind the keys and paper, the box was wide open and Claire could see inside complex wiring and electronics that she had never seen before. A small lens protruded above the mechanics but the machine was clearly unfinished. Beside the machine was a wooden box just slightly larger than the machine. It had carvings in the sides and lid of birds in flight, though it too appeared unfinished.

"What is it?" Claire asked.

"This is a very special invention," her grandfather said, "My hope is that this box will help people when they need it most."

"But what does it do?" she asked, poking at the brass keys with her fingers.

"Well, you put a small bit of blood in this thing here..." he reached around a grasped a glass vial and placed at the side of the box, "... and then the machine reads your blood and tells you how you will die."

Claire laughed, "No one wants to know that, grandpa!"

He nodded but with gleam in his eyes behind his round spectacles. "Death is something that most people don't want to talk about, I agree. But I believe it's something we need to talk about, nonetheless. This machine starts the conversation only by telling you how it will happen."

"Do you mean if you're sick?"

"Perhaps, but any other way, as well. If it is an accident, or a sickness, or the result of a foul scheme, this box will tell you."

"How does it do that?"

"It reads your blood. Blood always tells the truth."

"But how does blood know? Blood is just blood."

Her grandfather gave her a small hug and heaved a sigh, "Many people have forgotten some of the deepest and best ideas in life, Claire. Ideas like 'There is nothing new under the sun' or 'Life is one great story that connects us all.' And life is more simple than what first meets the eye. We are all born, we all breathe, grow, and we all die. The experience is unique to each person but we all share in joy, pain, and grief in some way. And deep inside, it's our blood that tells our story."

"How?"

"That's another thing people have forgotten. Our soul is in our blood. Every little cell tells your story from beginning to end, from when you're born and how you grow up, to how you die. The smallest part of ourselves speaks with every other cell and every other person, whispering our beginnings and ends, but it speaks so quietly that we often do not hear them. This box helps make the telling of our stories just a little louder."

Claire became quiet. She was busy thinking whether it would be a good or bad thing to know how she would die or to talk with her blood. "Grandpa, isn't it scary to die?"

"For some it is," he answered truthfully, for he always tried to tell the truth, "There' a lot that we cannot know about what it means to die but we know it hurts a lot when we lose someone we love. And so I wondered, too, what could I do to make the telling of the ends of our stories a little easier. And then I had a fabulous idea! Do you want to hear it?"

Claire nodded once, up and down.

"I thought of you! I thought of how much easier it would be to get such news from someone I loved and trusted. This is part of the secret," he pointed at the lens at the open end of the machine, "From this little lens, when you choose to use the machine, the person most important to you will emerge and tell you how you're going to die. It helps to hear these things from someone you love. Sometimes they can teach us what it means to die well."

"But how does it know who to show?"

"Your blood knows. You can feel it deep down when you truly love someone. That's because it's in your blood. Even when they're far away and you haven't seen them for a very long time, you can sometimes feel them speaking to you. That's your blood reminding you that you are loved."

He turned the stool away from the workbench and set Claire back down on solid ground, "But, that's enough for now. Come on. Let's go get dinner started. How does liver and onions sound?"

Claire wrinkled her nose, crossed her arms and stomped her foot hard. "Well," he exclaimed, "If not liver and onions then we'll have to have ice cream! That's all the food I have!"

Claire smiled and grabbed his hand, calloused hard from years of crafting. They walked out to the house, "I always feel better when you're around, grandpa. I feel it deep down. Is that my blood talking to me?"

"I think it is, and my blood says the same thing." He smiled wide until white teeth peeked through his thick beard. Patting her head they walked into the moonlit night towards a dinner of ice cream.

#

Claire didn't recognize where she was. The walls and floors were white and everyone was wearing white clothing. All the brightness reminded her of her grandfather; white was his favorite color. Claire would have done anything to see her grandfather at that moment. She was tired, cold, and in pain. All the strangers around her kept saying how brave she was but she didn't want to be brave. She only wanted to go home.

"I'm afraid its cancer." One of the men in white said. "A rare form of leukemia. There are some treatments, some things we could try to fight it with, but I'm not going to lie to you. Not much is known about it and there's no guarantee anything will work and it will be very hard to fight."

"How long?" Claire's father asked. It looked to Claire that he was angry so she was too scared to say anything.

"It’s hard to say. Everything points to a slow growth, but if it’s metastasized to the lymph nodes then I'm afraid I can only put the survival rate at 10%. At the current rate of growth with chemotherapy and treatments, maybe two or three years at most."

Her father sighed and her mother began to cry. Claire was feeling scared and she didn't understand what was happening. There had been lots of needles and cold metal surfaces with strange lights and beeps. She knew she was sick but she didn't feel too bad. Surely it wasn't anything a bowl of soup and an afternoon of blankets and books couldn't fix.

"I know it’s difficult to hear but some decisions need to be made soon."

"Do everything you can." Her father said sternly.

"I just want you to understand. This can be a hard and painful process, and with the survival rate being what it is there are other options that can improve quality of life..."

"No." Her father almost screamed, "Do everything you can."

"Very well." The man in white jotted down some notes and nodded.

The three adults looked to Claire in the hospital bed. Her parents crouched beside her while the man in white smiled and squeezed her hand. He was kind, but there was something not right about that smile to Claire. It wasn't warm, like the way her grandpa used to smile at her. When grandpa smiled she felt it deep down, "in her blood" as he used to say. The stranger's smile was more like a mask, distant and fake. Surfacey. Not deep at all.

"I don't like it here. I want to go home."

"Honey, you're going to have to stay here for a while." Her mother said as she knelt next to her. She wiped Claire's cheeks that were dry as tears poured down her own. Claire didn't understand why she was crying but she knew something serious was happening.

"Mom, what is it?"

A nurse came up and poked Claire's arm with a long needle. The pain shot up to her shoulder but she only watched as the blood traveled through her veins into the clear plastic tube.

"You're very sick, dear." It was all her mother could say before sobbing.

"Grandpa says our blood speaks to us." Claire said as she watched the blood be taken from her.

"Your grandfather said a lot of strange things, Claire," her father said.

"Is grandpa coming to my eleventh birthday?"

"No, dear, grandpa isn't coming to any more of your birthdays. We talked about this. Grandpa's gone."

For some reason, Claire kept forgetting what had happened. It was only last week when her father woke her in the early hours of the morning. She could hear her mother crying in the other room. Her father spoke her name loud enough to wake her. When she rubbed the sleep from her eyes she saw him sitting on the bed next to her, his face blank showing no emotion.

"I have to go, Claire." He began, "Last night, grandpa had an accident. I'm afraid he's gone, Claire. Grandpa's gone."

He spoke in a very matter-of-fact tone with lots of nods and eye contact. But he never hugged her.

Claire felt numb. "What happened?"

"He was walking home from a lecture at the college late last night. His neighbor was outside on the roof doing some stargazing when he took a misstep and knocked a telescope over the side. It hit your grandfather as he was walking underneath."

And that was it. That's how grandpa died. It wasn't until she was in that hospital room with all of the white and strangers and big words like 'leukemia' and 'chemotherapy' that she began to feel like he was really gone. Tears began to stream down her face.

The man in white clipped something to his notepad and turned to the father. "For what it's worth, I'm sorry. I'll do everything I can."

"I know. And thank you, doctor. What would be the plan from here?"

"Well, we'll keep her overnight for more tests, start her on chemo every six weeks..."

Claire could hear the voices trailing off but could feel something else growing inside her. She began to feel fearful, like she was standing before a great mouth that was yawning to swallow her whole. There came a ringing in her ears that wouldn't stop, and the sounds of voices became less and less until she could her nothing else around her. She could only think about how much she missed her grandfather and the hurt of his death clamored over all of her senses. Claire closed her eyes and went inward. No one around her seemed to see her, so she tried to see herself. She could feel, deep down in her blood, a cavernous yearning and pain. She never felt anything so terrible and she was scared she would become lost in the interior world of grief. It was then that another pain shot up her arm and suddenly she was back in the room with white walls. A nurse had put in a small needle that was connected to a large bag holding a clear liquid. Claire's arm ached as she felt the cold juice run into her veins.

"So you've finally woken up." She said, "You were asleep for quite a while!"

Claire didn't feel she had slept at all but she noticed she was in a different room. Claire looked around and saw that her parents and the man in white had gone. The nurse took notice of her searching eyes.

"Your parents stepped out for some dinner but they'll be back soon." She ripped off her blue gloves with a snap. "They left that letter for you. They said it’s an early birthday present."
Beside the bed was an envelope with two words scribbled on the outside, 'From Grandpa.' When she lifted it Claire noticed it felt heavy; there seemed to be more than just a letter inside. She tore open the top and gently pulled at the parchment with trembling fingers. She read the words on the page:


Dearest Claire,

First and foremost, I'm sorry I will not be there for your eleventh birthday. It seems that this world has a different plan for me.

I had hoped to see you grow into a beautiful woman, to watch as you learned and loved and walked the path of discovering yourself. There's so much I had hoped to teach you but I'm afraid I must leave your life a bit early. I used my greatest invention today and it told me how I would die, and judging from the words I had surmised that I would be dying soon. But the news came from the lips of a face that looked like yours, so it wasn't terrible. To be sure, I've lead a wonderful and joyous life and it was made better because of your love. Even though I may be dying in body, know that my blood is always a part of yours and that my love is just as close to you as your next breath of air.

One day, when you're ready, use this key to access my machine. Only use it if you truly want to know how your story will end. Remember, it MUST give a prediction when used and you may not like what you hear even though the news will come from someone you love. But I've taught you all I can with the time I had and someone who lives well has nothing to fear of death. So it is with me. Though I must admit I am curious to learn how it will actually happen... I left you my prediction so you too can see how odd it was.

I will cherish you always and if you ever call out my name, I promise I will hear you.

Remember, we are all connected.

Your Grandpa


Inside the envelope was a small brass key and a tiny slip of paper that read NEXT FULL MOON.

Claire cried. Even though she knew her grandfather meant every word of that letter, she didn't feel loved or heard. He was gone. In those moments after reading the letter Claire never felt more alone in her life. It felt as though her very blood was shaking in anguish. She retreated inward again, trying to make herself feel as she did when her grandfather would see her and smile. She tried to remember his face with the round spectacles, funny wrinkles, and gray beard. She tried to hear his voice and feel his calloused hands patting her head. But she couldn't. It was almost like she forgot. No, it was more like her soul forgot, her blood forgot. In the darkness of herself, in that loneliness, Claire didn't know what to do. She felt the world around her begin to disappear in despair when a stab in her arm brought her back to the present moment. She must have been shaking; the small needle in her arm had gotten loose and had come out with a jerk at her vein. It was dripping slowly onto the floor. She lifted to look at the needle closer and she saw a few small drops of blood on the tip. The pain inside was too much to bear, yet the pain in her body and underneath her skin would bring her back. A sharp stab saved her from the sadness. For Claire, there was nothing worse than the thought of never seeing her grandfather again. She took the needle, bit her lip, and stabbed it back into place.

That time the pain felt better.

#

"Claire? Where are you?" Her father's voice was muffled through the wood and insulation, like a voice that whispered in her head.

Claire was hiding. She was doing a lot of hiding the past few weeks and this time she chose the attic as her secret place. She liked the attic because her parents never thought she could get up there and no one ever found her. It was dark and musty and smelled of rotting wood, but at least she could be alone. She was in the dark and had nothing with her but a Swiss Army knife and an old yellow flashlight with a burning-out bulb. She hit it once to get it shining again.

She held the small Swiss Army knife that had been a present from her father for her fourteenth birthday. Its blade was open and wet. Claire had made a small fresh cut just above the crease of her arm. The scars on her skin from countless IVs and surgical procedures mixed with the scars of some of her personal incisions. Some were made by doctors. Some were made by her. She poked at the newest line with her pinky. The muscle beneath responded and surged with a new mound of blood. The pain was too dull to notice anymore but it kept her out of her head still. Claire watched as a small drop of red weaved and rivered its way between the hairs of her arm down to her elbow. She was comforted by the sight of her own blood. It helped her to remember that she was still alive even if she didn't want to be, and a part of her still believed that her grandfather was in that red liquid somewhere. Over the course of the last three years she had lost weight, any sense of dignity, and almost all of her hair three times. She knew it would never grow back to flow past her shoulders again.

She was still feeling a little sick from the chemotherapy the day before. Her cancer had slowed its growth but her body was exhausted. She was scheduled for another visit later in the day. That's what she was hiding from. She hated the hospital. Nothing but machines and needles and people who look at you but never saw you. Some days Claire was strong and she could handle it but today wasn't one of those days. She toyed with the small, brass key that hung from her neck when there came a distinct sound.

*click*


Claire jumped. The sound came from a dark corner of the attic but she wasn't sure from where. Did her parents finally discover her favorite hiding spot?

*click*

She jumped again. It was a short sound, but clear. She shined the flashlight toward the corner and saw a stack of boxes covered by a dark green blanket.

*click*

Claire pulled at the blanket with a swift tug. The sound was coming from a small box in the middle of the stack. Claire grabbed the box and pulled it out. It was heavy with an ornate lid carved depicting birds spreading their wings and a small keyhole on the front. She slowly placed it on the wooden floor before her and shined the flashlight on it. The light flickered and warmed the decorated lid so that the carved birds appeared to be flying off the paneling. That's when she knew what this box contained.

*click*

Hands trembling, Claire took the key from her neck and pushed it into the keyhole. She turned it clockwise and the lock gave way with a mechanical shift. She slowly opened the lid to look inside.

*click*

It was the machine from years ago, the one her grandfather had made, the one that could tell you how you would die. Claire remembered the typewriter look, the brass accents, the deep wood paneling, but the machine looked complete. The glass vial rested on the side awaiting a sample of blood and the paper spindle was slowly turning.

*click*

The paper jerked in the other direction as if it were catching on some internal mechanism. Claire slowly removed the paper to find a piece was caught on the turning gear. Had this machine been on all this time? Her grandfather had been dead for years. How was it still functioning?

The clicking ceased. Claire removed the machine from its ornate box and placed it squarely on the attic floor. The light of the flashlight danced across the brass and varnished wood. The machine looked pristine and newly polished. It had an old-fashioned look, but she knew that the mechanics inside were as advanced as technology could get in their time, perhaps even more so. Despite what everyone believed, Claire knew her grandfather was a genius. She smiled remembering his odd sense of style; mixing the old and new.

There were small plaques of gold adorning the sides and face of the machine. Claire read on the left, "Always tell the truth" and on the right "Everything is connected." These were common sayings of her grandfather but the message on the front was the most enigmatic, "Die well."
"I've wanted to," Claire said to herself upon reading the plaque, "Life's been too hard to live since you've gone."

Just then, Claire remembered what her grandfather told her about the machine. It let someone find out how they would die but from the mouth of the person you loved most! She also remembered the words of his letter that said if she were to use the machine, she would have to hear how she would die. She knew it would be her grandfather who would said those words. She knew it in her blood. But did she want to know how she would die? The question nibbled at her mind for a long time. There was still some small hope that she could beat the cancer but Claire was tired of hoping. She wanted to see her grandfather again, to feel his love deep in her blood again, but she was afraid that she forgot how to feel. Her blood had stopped talking a long time ago, ever since he died. She imagined that darkness she encountered when she went inward had killed the voice of her blood somehow. She decided she didn’t care. Claire believed she would be dead in a year from the leukemia and chemo. She felt herself getting worse and worse each week, and to her it was only a matter of time.

There was nothing to lose and so the knowledge of how she would die became no great sacrifice. She took the vial from its brass rigging and held it in her right hand and grabbed the small Swiss Army blade on the floor with her left. She remade the wound above her right elbow and fresh blood flowed. Claire relished the pain, the feeling of something for just a moment and with hands trembling she began to catch the blood in the glass vial.

Claire didn't know how much blood was needed, and so she filled it almost to the top. She screwed the glass vial back into its brass rigging, turning it upright, and waited. She didn't know what to do next. There was no button to turn the machine on, it seemed; just the buttons of letters and numbers. But after a few moments there was a sound of a quiet vacuum and the blood emptied from the vial. It flowed through small glass tubing that protruded in separate places from the wood paneling. The paper spindle began to shake and spin and words were typed all on their own:

PLEASE ENTER YOUR FULL NAME:

Claire carefully entered the requested information, using two quivering fingers to peck out her moniker and making sure she made no mistake.

CLAIRE ANNE PETERSON

The machine whirred and buzzed, the paper fed then responded with a new typed message:
HELLO, CLAIRE. I WILL NOW BEGIN TRANSCRIBING YOUR DNA. PLEASE WAIT...
Claire waited. And waited. Nothing. "Maybe it’s broken," she thought to herself. But the machine began typing slowly in front of her.

AGTCGACTGAGAGAAGTCCTCTAGTCTCGACTTCAGA
UACUGCCUAGUCGGCGUUCGCCUUAACCGCUGUAUU

Letters began to flood onto the paper. Letter after letter after letter until the machine was typing so fast that they became a blur. Millions of letters must have been typed, and it seemed there was no end to the ink and paper. Several minutes of this whizzing transcription past when there was a sudden stop to the paper spindle.

DNA TRANSCRIPTION COMPLETE.
PERSONAL DEATH PREDICTION VERIFIED.
DEATH PREDICTION ADVOCATE SELECTION COMPLETE.
FACIAL AND PERSONALITY CONSTRUCTION IN PROCESS
PLEASE WAIT...

For what felt like an eternity, there was complete silence. Claire didn't even notice when the flashlight sputtered out. She was there in the darkness and she began to go inward, fingering the path of blood that was on her right arm. A low click and hum came from the machine as a lens rose out of the top and began emitting a soft blue light. Slowly, small shapes of squares and lines began to grow from the surface of the lens. Claire watched as a face began to take shape before her, much larger than real life. At first, it was just a plain blue face, but lines and dots began to mark the spots of wrinkles, hair, and spectacles that created the face of her grandfather. As if by magic, he was there. Claire recognized every wrinkle and hair, and the face looked down at her with those kind, twinkling eyes. It was the moment she had waited for.

The face spoke, “Hello, Claire.”

#

Claire stared at the fuzzy, pale blue face not knowing what to say. She trembled as a single tear ran down her cheek.

"Grandpa?" Claire said.

The wizened old face blinked and looked down at her, smiling kindly. The face was a deep blue with horizontal static lines running its length with periodic waves that distorted the image. Claire could see each point of the face she missed so much: the long beard and bald head, the bushy eyebrows sticking out from behind the round spectacles, the small mouth that was buried underneath a thick moustache, and his eyes; those kind, gentle loving eyes that she had searched for ever since he died.

She reached out to touch his beard, his wrinkles, his round spectacles but all she could grasp was air. The face of blue lines would only shake and adjust to her fingers, rematerializing after they left the projection of the machine.

"Hello, Claire." The face said again, with all the love and kindness a grandfather could have.

"Grandpa," Claire said between fits of tears, "I've wanted to see you for so long."

"It’s alright now. I'm here."

Claire could no longer contain her grief. She cried there in the attic, kneeling, her knees to her forehead hiding her face. She couldn't stop from shuddering. There were moments when she couldn't breathe but the face from the machine only looked on, the pale blue glow illuminating the room.

She took a deep breath while the tears subsided and her body stopped convulsing. "Why did you leave, grandpa? Why did you go when I needed you most? If you knew when you were supposed to die, why didn’t you try to stop it?"

"I'm sorry, my love." The face said, "I would have stayed forever if it meant to save you pain. But I had no say in the matter. I could not have stopped my death any more than I could stop the rising of the sun.”

"I need you here with me." She cried again.

"I am here with you, my beloved child. I am always with you."

"It’s not the same," she protested, "I need to see you here, to feel you here. I've needed to hold you for so many years but you weren't there."

"I was there, just not in the same way as before. I've watched every tear you've cried, heard every scream you've yelled, felt every cut you've made."

Claire instinctively covered her arms. She told no one about her cutting and there was no one yet to question the marks. She found herself embarrassed and ashamed.

"You do not need to hide from me, child. I know the loneliness you've felt. The yearning you've had for it all to end."

"I just want to die..."

"I know. It's been so hard for you. I wish I can take your pain away but it is yours to bear."
Claire sniffed and avoided his eyes. "So am I going to die?"

The blue face stared at her. It did not answer right away and Claire was beginning to think it was broken somehow.

Just before the silence became unbearable, the face spoke, "Everyone dies someday, Claire. What matters is not how or when we die, but whether or not we die well."

"And how does someone die well?" Claire asked.

"By living well," the face replied, "Sharing love, confronting fear, making peace, helping others... these ideas are simple but they make living and dying all the more easier."

Claire shook her head, "It’s too much. It’s all too much... I can't stand it anymore..."

The face said nothing. Claire began to cry again.

"This is your story," the face said, "No one can tell it but you. While the tragedies that happen to us may or may not be set in stone we still have the choice to either be defeated by them or to grow from them."

"And what if we can't grow?" Claire asked, "What if we just die?"

"Death is only another opportunity to grow, dear child. I should know," the face smiled, "With each moment I tried to leave this world with a little more love than when I found it. Even to my dying breath I thought about how grateful I was to have you in my life."

Claire wept again. She felt as though all she was were tears now. “I think I just forget how to live, ever since you died.”

"I know, Claire," the face paused, "My time is almost up. How do you believe you will die?"

Claire wiped away her tears, "Cancer." It had become a word she spoke too often, a word she had become too familiar with.

“Then that is how you will die, Claire.” The face spoke with a sigh, “If you give up, if you choose to be defined by your disease then that is what will claim your life. In fact, if that is your choice, then it already has.”

“I don’t care anymore.”

“Tell the truth, Claire. I know you better than that.”

"Why does it even matter?"

The face grew stern, "It is the only thing that matters. You have the power to choose what your life means. Search deep down, Claire. What is your blood telling you?"

Claire closed her eyes and tried hear herself. Despite her fear, she went inward and confronted the terrible pain that she had been running from for years. But instead of it swallowing her whole, it whispered to her. It was her inner voice, her blood. What she had thought she had lost and forgotten was there all along, alone in the darkness of her deepest self. Instead of running, she chose to listen. "My blood... My blood wants to live."

"Good. I’m glad you can finally hear it again." The face smiled at her.

It was then that Claire didn't feel like crying anymore, "Thank you, grandpa."

"You're welcome, dear girl."

Claire stood and rubbed her arms. The blood had dried and her scars were visible, but she didn't feel like hiding them anymore.

"There's one more thing, Claire," the blue face said.

"What is it?"

"I have to give my prediction."

"But I thought cancer was..."

"That is what you predicted. Now I must give you mine."

Claire held her breath. The blood flood through the glass vacuum of the machine and the blue face looked at her with piercing eyes. Just moments before, Claire didn't care if she lived to the end of that conversation, but she could not deny, deep down, deep in her blood was a small glimmer of hope at life beyond cancer.

The face was silent and thoughtful but the paper on the machine was busy spinning away. It typed a single line of text and cut the sliver loose. It fell to the floor before Claire’s feet.

She read: 80th BIRTHDAY CAKE

“Well, isn’t that curious? Just as bewildering as my own prediction…”

Claire smiled for the first time since her grandfather died. She felt that old feeling of warmth deep in her blood. Her mind was racing past all the people she might know who were close to becoming 80 years old but she stopped herself and began laughing.

"I suppose it doesn't really matter." She said.

The face laughed too, "No, it doesn't. What matters is how you share your love with the time you have. Remember that, Claire." The blue lines that made the face were beginning to wave and static. He was fading away.

"What's it like to die, grandpa?” She asked before he was gone.

"It isn't as bad as most people fear. And there are so many wonders to see after!" The face fizzled down to bits of dots and lines. The bright blue glow grew dimmer and dimmer until there was nothing left.

"Goodbye, grandpa."

Claire grabbed the flashlight and hit it once. The light flickered on and Claire crawled down the attic steps, leaving behind the machine and the Swiss Army knife but taking hope with her.

Monday, November 28, 2011

The Lake

The lake was clear that morning. The dark greens of the sand and dirt below the water shifted and clouded each time Desmond took a new step. The minnows schooled around his ankles as he waded through the shallows. The canoe was giving him a hard time that morning, scuffing against the rocks while he was pulling it into the lake. Desmond remembered it being easier to move last time. Desmond was also twenty years younger last time.

He had already tripped once getting the canoe through the landing and his overalls were soaked up to his chest, but Desmond was determined. His life kept him away from the lake for the better part of two decades and he'd be damned if he didn't find some time to spend out on the water now. Once deep, the canoe cut through the murky tarn like a knife through jelly. He jumped into the boat and paddled out. Not a soul was around. The lake was still save for his lone oar tapping the water.

It wasn't until he paddled out for about a half an hour that Desmond realized he forgot his rod. He looked behind his tackle box hoping it might be somewhere in the canoe anyway. It wasn't. It was back on shore in the back of his truck.

"Goddammit."

He was forgetting things more and more. Small things at first, but then bigger things. Small things like grocery lists and telephone numbers. Bigger things like how it was wrong to hit your wife.

She left him a little over a week ago. Or maybe it was a month ago. Time took a strange turn once she left. Desmond couldn't remember what the fight was over. She took Annabel with her and moved in across town with her sister. He didn't like her sister now that he thought about it, but at the time of her storming out he really didn't care where she went. He just wanted her gone. He hated his wife when she left. He hated how their fight ended, how Annabel cried as her mother grabbed her arm, how she even took the dog and stuffed him in the car despite his protests. It wasn't until he forgot his rod out there on the lake that he remembered he loved his wife. On that green water a half hour's paddle from any shore and another forty-five minute’s drive to another living soul, Desmond realized just how alone he was. The thought hit him hard like a hailstone on the head. He slumped into the canoe and covered his face to keep from crying. Covering his face didn't help.

That was when he heard the voice. It was nothing but a whisper in the wind.

"You've come back to me."

Desmond jerked up and looked all around, wiping his eyes and nose on his flannel sleeve. A light mist was beginning to rise from the surface of the water in the cool of morning, but there was nothing else to see. Desmond thought his hearing was starting to go with his memory when he heard the voice again, clearer and louder this time.

"You've been away for so long; I was beginning to think you had forgotten me."

"Who's there?" Desmond yelled.

"It’s me, don't you remember?" A gentle wind caressed Desmond's face. The breeze cooled the skin where his tears had dried.

"Where are you? I don't see you."

"I'm here. And there. And over there. I'm all around you. I'm under you."

Desmond wheeled around trying to follow the direction of the voice. He couldn't pinpoint it but it sounded close. There was no one there. Desmond grasped the side of the canoe and looked over to see if it was a swimmer playing a joke. But there was no one there either. Just his reflection in the water.

A small ripple went through his dark image. Desmond didn't remember looking so old. His hair had turned white, his eyes more sunken and vacant, cavernous wrinkles stretched across his face like deep cuts through thin fabric. Even his lips had affixed into a permanent frown.
"You've grown, Desmond." the voice said.

Desmond took one last look around the lake, hoping to find the reason his heart was beating so fast. "Where are you? Show yourself!"

"Look into the water." The voice answered.

Desmond looked over the canoe again only this time he saw no reflection. There was only a blackness staring back. The water had become dark and opaque and it seemed to drink the light of the sunrise. Desmond could see nothing.

"Look deeper."

Desmond moved his face closer to the dark water and peered just beyond the reach of the illuminating dawn. He thought he could see a form moving in the blackness. It was too big to be a fish and it was whispy, almost like a kind of seaweed or drifting sand. The smell of the water, that green and brown smell filled Desmond's nostrils as he leaned closer and closer to see. The whispy strands floated to the flow of the current and then suddenly revealed a face; cold, lifeless, and dark except for the pale white orbs that were its eyes staring straight into Desmond's. He fell back in the canoe at the sight, clutching the side of the boat with one hand and his chest with the other. He let out a small grunt that was meant to be a scream but the sound caught somewhere just beneath his ribs.

"Do not be afraid, Desmond," the voice whispered, "It is good to see your face once more."
Desmond was panting but his heartbeat slowed. At first he thought he was going into arrest but he then realized there was something strangely comforting about that voice. Something familiar. The cool air off the lake filled his lungs as he breathed heavy. It was an odd feeling of nostalgia, the sweat on his forehead mixed with the mist around the canoe and it was as if he was remembering something from a distant, forgotten part of his soul.

"Who are you?" he asked, shaking.

"Do you not remember, Desmond? You once called this lake your home. You would play beneath the skin of my water. You would drink from me as a child from his mother's breast. You would whisper secrets to me and they would ripple to my heart. We shared our pains, our joys, and our sorrows were lighter when you were with me."

The memories came crashing into Desmond's mind like a wave. He remembered at the young age of six, skipping rocks across the lake and speaking to someone far away. He remembered at seven diving deep into the darkness of the lake trying to reach the bottom. He would reach out to touch the dirt at the basin and instead would feel a hand reach back, cold fingers grasping at his own. He remembered countless early mornings just before dusk wading through the shallows and hearing distant sighs of someone in ecstasy as his feet mingled with the mud and minnows. Then he remembered the woman.

"I do remember! I was... I was just five years old. You saved me. I was drowning. Nobody saw me fall and I couldn't find the surface. But you found me. You found me and gave me air, didn't you? You... you kissed me and gave me a chance to breathe."

"... Yes." The voice sounded full of relief. Slowly Desmond crept to the side of the canoe and again looked into the deep. The face was still there but with eyes closed. She appeared to be crying as small bubbles of air collected around the corners of her eyes and floated to the surface.

"I do remember. Thank you."

She did not respond.

"But... what are you?"

"I am the lake. The lake is me." The voice spoke but the lips of the woman did not move. Desmond looked mesmerized into the pale eyes of the face that looked back. Green stands of light darted across her features as the reflection of the morning sun brightened the waters around her skin. "I am very old, Desmond. This lake is my home and my coffin. I died here a long, long time ago. I've longed to see your face again, to hear your secrets again, to be with you once more. I saw your tears, Desmond. Tell me, what troubles your heart?"

"A woman," he said. "A woman I loved has left me."

"For someone you love to leave you... that is the hardest pain."

Desmond could feel the tears well in his own eyes, "I've never felt this terrible." He wiped his nose on his flannel sleeve again, the hardened crust of his previous wipe stinging his reddened nostrils. He sniffed hard feeling the cool lake air fill him once again, "I want her back more than anything."

"Do you still love her?"

"Yes."

"Even after she hurt you this way?"

"Yes."

For a while the voice said nothing.

Then the lake trembled. Ripples rose around the canoe and he saw the sliver of fingers break the surface of the water. After the fingers came an arm, then a raven black mass of hair, a pale dark face, thin shoulders, and a small pair of breasts that glistened as the water melted from them. The woman leaned her arms on the side of the canoe and her hair tangled over her shoulders dripping the lake into the boat. Desmond smelled the water, the fish, the seaweed, and the woman. It was the same smell that entered his nose at five when he was drowning and breathing the lake and scared to lose his life.

The woman stared at Desmond with a new set of eyes. Beautiful, dark brown eyes that Desmond could not look away from.

"I will help you, Desmond." The woman spoke from her own lips, "This lake has secrets, too, and I've learned how to use them over my many years beneath its surface."

"You're going to help me get her back?"

"That is for the lake to decide." She looked away as if to recall some distant memory. "The lake will hear your desires and make judgment. But it will help you find what you seek."

The lake had begun to fog, and before Desmond realized he was surrounded in white mist. The canoe lapped at the surface of the water and the ripples went as far as he could see but the shore was now hidden from view. All he could see was the water and the woman.

"I need her back. I need her. I've got nothing without her or my daughter. She'll take everything from me for what I've done."

"Your worries will soon be over, Desmond." The woman climbed into the canoe. Desmond stood to prevent it from tipping but he felt no rock to the boat as she entered; it was as if the woman were weightless. She floated close to him and embraced him, the wet from her arms and breasts soaking into his overalls and flannel shirt. He felt the cold chill of the lake touch his skin and he closed his eyes.

"How can I get her back?" he asked.

Suddenly, the canoe hit rock. Desmond toppled and fell to the floor of the boat. He saw that he had somehow drifted to shore. He turned back to look across the fog covered lake. The woman was gone. But he heard the voice one last time.

"Come back tomorrow at sunset and you will have your answer."

______________________________


"You must do exactly as I say, Desmond."

He was standing in the canoe in the center of the lake. A chill wind stung his eyes. The woman was nowhere to be seen, but her voice spoke with a clear conviction.
"Beside you in the water, you will find a knife made of bone."

Desmond looked and floating there was a shaft of pale white like the spine of a dead fish. Desmond lifted the knife from the water as a small stream of mud and ooze loosed from crevices and holes in the hilt. Desmond examined the blade. It was thin and brittle with one edge sharpened. He touched it lightly to his finger and felt small jagged spikes that stuck to his skin.

"Cut open a wound in your hand."

Desmond looked around him, startled.

"You must do this, Desmond. The lake must taste of your blood to tell you your secret."
Slowly, Desmond lifted the blade to his open palm and stretched his arms over the water. With a quick stroke the jagged edge of the knife bit through his skin and he could feel the dew on the blade enter his blood. It was cold.

A steady river of red poured from the wound and trickled from his wrist into the water below. Desmond watched as the deep red droplets fell, mixing with the orange of the twilight sky and then the dark green of the lake. Swirls of steam hissed as more drops touched the surface of the water, and a gentle bubbling belied some movement underneath the surface.

"Now what?" Desmond asked.

"Now you wait," the woman replied, "You will receive your answer soon."

Desmond sat in the canoe and ripped part of his flannel sleeve from his shirt. He placed the jagged bone knife down and dabbed at the blood in his hand. The wound went deeper than Desmond had intended. He wrapped the cloth around the cut and tied it with his remaining hand and teeth.

"There," came the soft voice, "Your secret."

Amidst the greens and reds mingled in the lake came a small beige scrap of paper. Desmond leaned and lifted the soaking slip and held it with both hands. He gazed at the four small words.

IN HER LOVING ARMS

"I don't understand." He said, "What does this mean?"

"That is how you will die, Desmond."

"How I will die?" he could feel his blood beginning to race, "What do you mean how I'll die?"

"This lake is a special place, Desmond. The veil between life and afterlife is thin, especially here. The lake sees things. The lake hears things... it hears the cries and desires of all who come near. This lake took my life once, but out of pity. It took my life so that it could help others who've experienced the terrible pain of losing someone you love."

"But how does telling me how I will die help me get Irene back?"

"Read the words again, Desmond. See the phrase? See the meaning behind the words? You will die in the arms of a woman who loves you."

"But it could be any woman, couldn't it?"

"That could only be true if any woman could fall in love with you."

Desmond felt his heart skip a beat. There was only one woman in his life who ever truly loved him, and he knew it. Irene.

___________________________


The rain was falling hard and the mud at Desmond's feet was giving way to the hard stone underneath. He tried to shake off some of the grime but it clung to his soles like fleas on a dog. He pounded on the door one more time.

"Irene, you're not listening to me!"

"I'm listening to you, Des, and I'm telling you you're crazy." A voice inside was muffled by wood and vinyl paneling.

"You can't fight fate, Irene! I know how this ends and you'll come back to me!" Desmond kicked at the door and a bloodhound jumped at the window on the other side. His mouth frothed with white foam from all his barking. Desmond stepped back, surprised that his own hound didn't seem to recognize him. He put his wide brim hat back on and strode slowly to his truck, wet and angry. He climbed inside and wiped the rain from his face with his handkerchief. He didn't notice Annabel in the seat next to him.

"Are the things mom saying true?" she asked quietly.

"God almighty!" Desmond startled. She sat with her legs crossed, twisting the bone knife in her hands. "Annabel, you can't creep around like this. Does your momma know you're out here?"

She shook her head. Her dress and hair were wet with rain.

Desmond sighed and reached into the back seat and pulled out an old woolen blanket. It was stiff and scratchy but warm and Annabel pulled it tight around her.

"Now, what's your mother been saying about me?"

"Bad things, daddy. She says you're a no-good devil, and that you'd run out on us first the chance you get."

"Now darlin' you know that's not true."

"She's says you've been running around with Ms. Thompson from the general store. She says she saw you being too friendly with her."

"That's a bold-faced lie." Desmond said, a little too loudly. Annabel didn't have a response.
"Your mom and I have had some hard times. I might've said some things I shouldn't have said. Might've been a bit too hard on her. Never should have struck her." He sighed. "But I love your mother. She's my wife, and I promised I'd take care of the both of you. I know I'm going to win her back someday."

"She hates you, daddy. She says she's always hated you." Annabel said sadly, "What makes you so sure she'll take you back?"

"I've seen the words, Anna. I know how I'm gonna die. It might be tomorrow and it might be in a hundred years, but I'm gonna die with that woman by my side. My secret said I'd die in her arms."

"Did it say it'd be mom?"

"It said that those arms would be loving, and I don't know of any other woman to love me other than her."

"But how do you know it won't be some other woman? Christ, how do you know it won't be in my arms?"

"You watch your mouth, Anna. I don't wanna hear any more blasphemy." She turned away and watched the rain outside. Desmond wiped the brow under his hat, "I suppose I don't know, not truly. All I know is that you and your mom are the only things I've loved in this life and you two are the only things that have ever loved me. I suppose it’s got to be one or the other that I die with. And I suppose that isn't so bad, the more I think about it." He leaned over and kissed her on the forehead.

"I don't want you to die, daddy. I don't want you to leave either." She had tears, "I just want everything back the way it was."

"It will be, darlin'. It will be. I promise you." Desmond started the truck and shifted it into gear. "How's about we let your momma cool off a bit and we go get something to eat?"
"Not right now, daddy." Annabel opened the truck door and stepped out into the rain, still clinging to the woolen blanket. She turned to face him, "You never should have hit her." The door slammed shut with a high-pitched creak and clang. He watched her walk through the mud and wet back to the house. Desmond sat there a long time, his foot pressed to the brake. After a while, the rain stopped as if waiting for something to be said. The sun had set and the lights in the house had gone dark before Desmond turned his headlights on and began the long drive home.

_______________________


"You get out. I don't want anything to do with you." Irene was busy adjusting the table lamp and drapes. She tried not to notice when Desmond walked into the living room.
"Just hear me out, Irene." Desmond started.

"You don't have anything I want to hear. We're through. Was it Annabel that let you in?"

"Damn it, Irene, we're not through! Just listen to me."

"No, you listen to me!" she turned to face him square in the face, "For twenty years we've been married and you never once raised a hand against me in spite. But as soon as I catch you talking to that pretty little thing in town you seem to get it into your head that you want something more. Well, you go and have you're little fun, Desmond. But I'm gone. And I'm taking Annabel."

"You've gone insane, woman. I've never cheated on you and never would."

The sun came in through the windows like a stranger looking in. It hit the floor in a checked pattern that brightened the greens and reds on Irene's flowery shoes.

"I don't care if you did or didn't," she said, "I want you out of my life and out of my home. I'm not about to risk you striking Annabel."

"Irene, I would never..."

"I'm seeing someone else." She said suddenly, "I spent over twenty damn years of my life with you and all it got me was a headstrong daughter and a black eye. You're worthless and I'm not about to waste any more time with you."

The words cut Desmond like a bullet through the chest. The sunlight was on her face now and he could see the wrinkles on her brow. She seemed older than he had ever noticed at that moment. The sadness and distance in her eyes were more than he could bear. He looked away.
"Who is he?" he asked. It was all he could think to say.

"Never you mind who he is." She said, returning to the lamp and drapes, "He makes good money and he treats me kindly, that's all that matters."

Desmond was too angry to cry. His fists balled. He was tempted to hit her again. Was this how the lake worked its magic?

"Tell me his name."

"I'll do no such thing. I think it’s about time you left, Des. I don't want to see your face again."

"You'll tell me his name!" He grabbed her by the shoulders and shook. He didn't think it was hard, but she gasped in pain. She slapped him twice but he caught her hand at the third swing. He put fingers to his lip and felt blood seeping down his chin. In anger he pulled a fist back and aimed to make another black eye. It was a voice that stopped him.

"Daddy?" Desmond heard Annabel from the stairs. She had crept in and was seated on the topmost step, looking down into the living room.

"Annabel..."

"You said you would never hit her again."

"I know, and I meant it." He let go of Irene.

"Then what were you going to do just now?"

Desmond knew he was caught. Irene smiled a wicked smile at a criminal who had just been convicted.

"See what I told you, Annabel? He'll just hurt us again if we stick around."

"You shut your mouth. You've got no business running around with another man. Dammit, I'm still your husband."

"You're no husband of mine," she laughed, "Get your things, Annabel. We're leaving."

Annabel had already disappeared from the step and she was heard crying upstairs. Once he knew she was out of sight Desmond grabbed Irene and pulled her close.

"You've poisoned her against me." He spat as he spoke.

"It wasn't hard to do. It seems she already knew what kind of man you are." She wretched free from his grip and walked upstairs. Desmond could hear her soothing coos and whispers in Annabel's ear. He sat in the easy chair with the white linen cloths spread on the armrests and stared out the window with the checkered pattern drapes. It was raining again and lightning began to flash through the windowpane.

After a few minutes Irene came stomping down the stairs with two suitcases and a bright red straw hat. Annabel followed her down more slowly and the dog took up the rear with tail wagging as if nothing was wrong.

"We're leaving, Desmond. I'm not telling you where we're going this time," Desmond thought she almost sounded cheerful, "Don't try to find us. I've told the police everything and they'll hunt you down if you try any funny business."

Desmond tried to talk but couldn't. His life was crumbling around him and all he could do was watch Irene's flowery shoes as they stepped in and out of the lightning flashes on the floor.
"Nothing to say now, hmm? Well, I suppose guilt would silence any man from time to time. Come along, Annabel. We have a long drive ahead of us."

Desmond looked to Annabel as they walked to the door. For a brief moment she looked back. "You promised." It was all she could say as tears dripped on either side of her mouth. Irene pushed her through the door into the rain and the dog ran passed them, barking.
"Des, dear, you look terrible. You have blood all over your overalls." She gave one last smirk and slammed the door. Desmond looked at his chest and saw that a few drops of blood from his mouth had reached his front pocket. He tried to wipe away the stain but it had already dried and he only smeared the red in deeper. He looked out to see Annabel and the dog jump into the backseat of the sedan. Irene threw the suitcases into the passenger side, slammed the driver's door and in three seconds she started the car and skidded off. He knew then it was over.

____________________


Desmond stood in the middle of the canoe out at the center of the lake. He stood looking out at the mist in the early morning hours wondering how everything got so bad. He still had his bloodstain on his overalls. The pain had subsided and the bleeding had stopped, but the horror was now full in his mind. He had no idea how long he stayed in that easy chair, but his wife and his daughter never came back. It felt as though he were dreaming. He couldn't tell if he was there in that easy chair for only a few minutes or for days. The weather outside the window had never seemed to change and he could only hear the last two words from Annabel's mouth, "You promised." All he remembered was that one moment he stood up from that chair and knew he had to come back to the lake. Desmond looked at his reflection in the water and he saw that he had become ancient.

"You've come back to me." the quiet voice said. Desmond looked into the lake to see the woman, pale black skin and white bulging eyes.

"You lied to me."

"The lake never lies, Desmond."

"They're gone. Irene's gone. And Annabel."

"I know how hard it is to lose a child."

"I loved her. I loved them both." Desmond's eyes were filling.

"I know you did. But they left you. They both left you."

A calm wind pushed at Desmond's back. He could feel the breeze like soft fingers stroking his hair. The woman rose partly out of the water, looking up to his face with those changed, beautiful eyes.

"I will never leave you.” She said, “I loved you, too. I promise."

Desmond looked into her eyes, now brown and deep. "You promise?" She opened her arms wide and Desmond pitched forward into them, numb. She embraced him as they sank below the surface of the lake. She kissed him for the second time in his life and water from her lips filled his mouth. It was the sweetest thing he had ever tasted. Her first kiss gave him life. Her second took it from him. Desmond felt the cold water soak his overalls, flannel, skin, and lungs. As his life began to leave him, Desmond’s last thought was of Annabel and how different her arms would have felt.

Tuesday, August 09, 2011

The Test

Tydus entered the stone hall with a heavy sigh. His feet goose-stepped and echoed off the hard walls sounding like a leak in the roof after a hard rain. He collapsed into a heap onto one of the wooden benches. The chainmail he wore seemed heavier, and the sword at his side stuck out at odd angle and its tip hit the floor when he slumped. The golden hilt jabbed into his ribs hard. Tydus winced and leaned his head against the stone wall a little too hard.

“What seems to be the matter, dear boy?”

Madam Sarai’s voice was sweet to the ears. Tydus had not even heard her steps in the hall. He stood with a jolt at attention. The Madam giggled.

“You don’t need to be so formal with me, Tydus.” She brushed a hand against his arm. “Tell me what has you looking so depressed.”

“Madam…” Tydus stammered, “I failed a Test of Courage today.” He looked to the ground when he said this. He noticed that Madam Sarai was not wearing any shoes. She was returning from her rituals.

“Oh, poor dear,” she said with a motherly tone, “Sit and tell me all about it.”

Tydus returned to the bench and the Madam sat next to him, taking his hand in hers. She was forty years his senior but Tydus still felt nervous when she acted so familiar. His voice cracked as he spoke.

“It was in town. I was with the princess, serving as one of her guard as she was out purchasing produce and food for the evening meal. It was at one of the stalls that I saw a man and a woman quarreling. They were clearly upset and they’re voices kept getting louder and louder. I don’t remember what they were yelling about but the man said something and the woman got all red in the face and began to walk away. She had long blond hair all in a braid and it slapped the man’s face with a snap as she turned away from him. She got a few long steps away, but the man rushed forward and grabbed her hair, almost pulling her to the ground. She let out a yell and he grabbed her arm as she tried to hit him. I felt so angry watching him hold her, and everyone could see she was in pain. But I just stood there and watched. I didn’t do anything to stop him. The princess returned and I took one last look at the fighting couple. His hand was gripping her wrist so hard that she was beginning to sink to the ground. But I just followed the princess away from the shop and didn’t look back. It was then that a voice shouted my name, ‘Tydus!’ I turned and it was Master Gaemon. I couldn’t tell at first because he was in disguise, but the quarreling man was Master Gaemon, there was no doubt. ‘You failed, boy.’ Was all he said, and he and the woman disappeared into the crowd.”

“Oh, you poor lad…” Madam Sarai patted his hand, “I wouldn’t fret over it. Most knights fail their first Test of Courage, especially one so hard to recognize.”

“Its a knight’s duty to protect those who cannot protect themselves, Madam.” Came Master Gaemon’s voice from the end of the hall. Tydus shot up from the bench again, only this time he stood too quickly and knocked Madam Sarai to the floor next to him. Torn between the decision to be at attention or to help the old woman off the ground, Tydus did neither, only looked back and forth between Madam Sarai and Master Gaemon.

“For God’s sake, can you do nothing right, boy?” Master Gaemon moved forward and helped the Madam from the floor.

“Don’t be so hard on him, Master Gaemon. It sounds as though he’s been through enough today.” The Madam had one hand on her back and one hand on Gaemon’s arm as she struggled to rise.

“I’ve said it from the beginning, Madam. I don’t need any boys for the Order of the Shield. I need men.”

“Give him a bit of time, and he’ll be a man, Master. He clearly as the heart.”

“Maybe so, but it takes more than a heart to make a man.” He gave a solemn look to Tydus, “I’ve seen too many men torn asunder to know that much. There’s stomach and strength that’s needed as well.”

“He’ll do better next time, I can assure you.” She smiled and patted his cheek as she walked by.

“Not with all your coddling, he won’t. Why do you think its taking these boys so long to become men, eh? You’ve spoiled them as if they were your own children.”

“All of the Order are my children, Master, even you.” She said with a wag of her finger. Her soft feet patted against the cold stone and then she was gone. Master Gaemon shrugged and turned to Tydus.

“Come on, lad. You’ve got work to do.”

“What would you have of me, Master?” asked Tydus, still shivering at attention.

“That woman you failed to help today has some chores for you. Since you failed the test, it is now your duty to seek her out and work for her for a week. Do anything she says, not matter how degrading, do you understand? Its as much a punishment as it is a lesson. And I warn you, she can be as mean as a bitch in heat. I expect she’ll work you to the bone.”

“Yes, Master.”

“Good. Now go. I expect better next time.”

Tydus ran out the hall, his mail and sword jingling with each step.

“God help us all if its boys like him that stand between us and the Mangs.”

Master Gaemon shook his head and walked to the courtyard. The moon was full that evening and he could hear the crickets in the forest to the north. It was a calm and cool evening, the perfect invitation for some meditation. Gaemon realized it had been days since he had experienced gnomite. It wasn't any wonder he felt out of balance during the Test today. He sat down with folded legs and open hands in the small patch of grass and bathed himself in the moonlight and sounds of the evening. He closed his eyes and slowly began to breath through his nose, focusing on the the sensations around him and within him, the beginning stages of gnomite. Faintly, the sounds began to be more distant and the sensations on his skin and hair seemed more intense. He began to feel the air as it entered his lungs, the blood as it passed from his heart through his veins, his muscles as each fiber contracted and relaxed. He cleared his mind of all thought and entered gnomite, the place of All-Being. It was there that he first discovered his own Courage and the source of his Strength. He breathed deep and allowed himself to sink into the All-Being, becoming almost nothing in the vastness of existence. Gaemon slipped out of time and place and felt at one with the world around him. Not just the courtyard and castle, but the whole kingdom. He could feel his spirit stretch across the land like the great sky overhead. He could hear the distant voices of men speaking in whispers in places unseen. He could feel the heat of Hatred coming from some far-off place but it was too far to see or grasp. Suddenly, like a bolt of lightning, a scream came from the tower above the courtyard. Gaemon broke his gnomite with a gasp. It took a moment for him to gather all his senses but then he was filled with a sense of dread. The scream came from the royal tower, from what sounded like the princess’s bedchamber. In a single bound Master Gaemon was off, bolting through corridors and passages, praying his brief negligence wouldn't be the end of the realm.

Wednesday, June 08, 2011

Ancestors, Pt. 3

“It’s terrible.” Charles said, “Complete garbage. You have more spelling errors than I care to count. Not to mention your punctuation…”

Charles threw the papers down onto the cafe table and small pastry crumbs leaped up and down on their plates. The bright afternoon sun formed solid shadows of the tree along the street. Emith and his brother sat beneath the shade of a large oak attempting to enjoy an afternoon brunch of fruit pastries and tea. Charles was taking time off work. Emith had no work to speak refrain from.

Emith sipped his tea gingerly as he collected the stack of papers that were his newest work. “Of course its terrible,” Emith said, “Its a first draft. And I do not recall asking you to be my editor. I asked you for your opinion of the content.”

“I didn't like that any better,” Charles said, sipping on a hot cup of Earl Grey, “The bit about the woman in red was the only interesting part so far, and even that lacked a certain dénouement.”

“I believe you fail to grasp the nuances of that word, Charles” Emith replied, rubbing his temples to prevent the oncoming headache, “Specifically, you don’t know the bloody definition!”

“No reason to be crude, brother,” Charles said, “It just needs work is all. It has no punch, no hook, nothing to keep the reader interested.”

“I don’t even know why I bother asking you. The last thing you read was some horror novella from that disreputable rag you insist on subscribing to.”

“The New Town Suspense Monthly is a legitimate publication. You should consider writing something for them. I’m sure if you put your creative energies into writing something with a bit more excitement you’d do well. I could even put in a word for you with the editor.”

“What, are they doing so terribly that they need writing suggestions from their legions of subscribers?”

“Don’t be cocky, Emith. It just so happens that he lives in the flat next door to mine.”

Emith laughed, “Of course he does.”

Emith took a bite of a small rasberry pastry. The filling oozed out of the opposite end onto his unguarded hand, the sticky sweetness clinging to the skin and hair. Emith cursed. He knew his hand would feel sticky all day now regardless of how often he washed it. How could such a small thing remind a person that everything has gone wrong?

“Some days you make a terrible brother, Charlie,” Emith said.

Charlie smiled, “Is this because I’m mother’s favorite?” Charlie tore a piece of his biscuit off and threw it at Emith’s face. It bounced off his cheek and landed in his tea.

“I’m actually at peace with that, Charles.” Emith responded, wiping his face, “Mother has often said that I couldn’t be more different than either of you. I used to question the wisdom of a god that would place me in a family such as this but I've resigned to the truth.”

Charles cocked his head, "That god's wisdom cannot be understood?"

"No," Emith replied, "That there is no god."

“You’re a strange one, Emith.” Charles laughed, “Even before father died, you were different.” He took a large bite from his biscuit, “Father coddled you,” he said between chews, crumbs spraying out of his mouth, “That’s why you turned out the way you did.”

Emith stared at him, “And what is that supposed to mean, Charles?”

Charles swallowed, “Don’t be daft, brother.”

Emith could feel his anger rising, “Humor me, Charlie. I want you to speak what you mean.”

Charles sighed and put down his biscuit, “Well, Em, where should I begin? You’ve got no job, no wife, no children, you’re being evicted from your apartment, and you're constantly pestering mother for money and advances. Your last success as a writer was years ago, and even that wasn’t a good one. It’s time to give up this cloud-chasing and act like an adult. Get a real job. Settle down. Anyone who knows you for more than moment can see that you’re a failure in almost any respect.”

Those last words were too much. Emith stood straight up, knocking the chair beneath him to the floor. The cafe patio patrons stopped as if on cue and stared right at him.

“I see,” he began, “I knew you always had a low opinion of me, dear brother, I just never knew it was this low.”

“Oh, stop being so dramatic and sit down. People are staring.”

“No, I don’t think I will join you any longer. I find myself suddenly lacking an appetite and empty of any desire to continue conversation with you. Good day.”

Emith grabbed his coat and hat. He was gone from the cafe patio in two strides with his brother calling behind. But Charles made no move to stop him.

Emith was tired, worn, hungry, and desperate. As much as Charles may have been right what hurt most is that the truth had to come from Charles. The golden boy, the one that grew up, the one that gave the grandkids and the money and the pride… He was everything that Emith was not. For his entire life, Emith only wanted to write. And for years he did and he was happy. But Emith was also uncompromising. He wrote what he wanted to, not what others told him to. That cost him many a newspaper column.

Emith’s anger raged and his mind raced through the downward spiral of self-deprication. Story after story, memory after memory played through his mind’s eye, each a remainder of Charles word, ‘failure.’

After a brief bout of suicidal ideation while crossing the pedestrian bridge over the Chicago River, Emith somehow found himself in front of his mother’s flat. Absently, he knocked on her door.

“Emith?” she answered, “What’s wrong?” She had the charm of an anxious mother at that moment.

“Am I a failure?”

“Oh, dear…” she wrapped he small arms around her son’s neck. After a brief moment of respite her wrinkled face looked up into his eyes and sweetly replied, “Of course you are.”

Emith was dumbstruck. “Thank you for your honesty," he mumbled, "I’ll be taking my leave.”

“You’ll do no such thing,” she grabbed his sleeve as he turned, “besides, there’s something I wanted to show you. I think you’ll like it. It may be just what you're looking for.”

She lead him into her living room amidst the ticks and tocks of countless wall clocks, “You really shouldn’t be so surprised,” she said as they sat on her velvet couch, “Anyone who sees you can tell you have yet to amount to much.”

“Charles said a very similar thing,” Emith said.

“Oh, pay no attention to Charles. True, he’s made a bit of himself but he’s always been jealous of your father’s love. You were always his favorite.”

“And Charles is yours?”

“I love both my boys equally,” she said, “Besides, he's much too prideful. Just don’t tell him I told you so. Here.”

She handed him a large shoebox. It was heavy to hold and felt as though it was filled with books. “What is it?” Emith asked.

“I found this cleaning up in the attic. Its the closest thing we have to family heirlooms.”

Emith opened the box and saw newspaper clippings, old photos, bits of stones, a small engraven plaque, letters still sealed in their envelopes, and many other items. It was a treasure trove of history dating back years and years.

“Who collected all this?” he asked

“Oh, several of your ancestors. I believe it was your great-great-great-grandmother that began collecting things. She kept all the things that were important to her and her husband at the time, and her children. There’s things in there dating back to the mid 1800’s when our family first came to this country. Many descendants since then have been putting small important things in there for generations. The last I saw of it was shortly after you were born. I think I placed a picture of you and your brother in there.”

Looking through, Emith saw early pictures of his parents, engravings of his grandmother, writings of his grandfather, the picture of himself and Charles… all things he had never seen before.

“I thought some of this might inspire you to write something new.” His mother said.

“Its beautiful,” Emith said, “There’s so much here, so much I don’t even know…”

“Emith…” she took his hand, “I know you’ve felt… different your whole life. To be honest, this family wasn’t quite a good fit for you. Your father died too early and you lost all connection with your brother and I.”

Emith began to speak but she stopped him, “I can’t give you what you’re looking for. I love you dearly, but I don’t understand you. I can’t, and you need someone who does. I worry sometimes that you won’t find anyone who can.”

Emith blushed. Her words were all true. He felt like he needed to apologize but he didn’t know what to be sorry for. His eyes avoided hers in shame. Instead he looked to the shoebox of heirlooms and glimpsed an old engraving at the bottom of the box. For a brief moment the world stood still and Emith gasped.

“Mother… who is this?” Emith asked.

“That? I believe that may be your great-great-great-grandmother," she replied, counting the 'greats' off on her fingers, "I never knew her myself; I understand she died quite young but she was the one that started this box.”

Emith took the engraving out to see more clearly, but his heart was beating as if it were going to stop at any moment.

“She’s quite beautiful, isn’t she? I like to think I took after her looks in my younger years.”

“Y… Yes.” Emith stuttered. His world was turned upside down, and he could not think clearly. There, engraved before him, was the woman in red. It was not a colored engraving but the straw hat, the dress, the face, the smile were all unmistakable. The woman he met at the cafe who claimed to know him, who claimed to be dead was staring back at him from that ancient engraving with the same look of joy on her face. It was that look that almost made him fall in love with her.

“Emith, dear are you feeling well? You’re all pale… you look as though you’ve seen a ghost!”

Emith swallowed hard. His throat was dry and he was feeliing dizzy, “I think I may have, mother. I think I have.”

Wednesday, May 25, 2011

The Rains

The fields were hot that afternoon. The hands breathed heavily like dogs panting from too much rabbit chasing. Cara stood and shielded her eyes against the suns. In the bright blue sky she could see dark, grey masses billow and flashing in the distance. She cursed. The harvest had come too late that year.

“Cara! Come inside! The Rains will be here soon!” her sister yelled.

“I see it,” Cara said, “We still have some time. Get the lesser hands into shelter and make sure the windows are bolted.”

Several of the fieldhands took their great baskets filled to the brim with ambrosia and began the long slow journey to the huts at the edge of the meadows. The gods had hoped to feast that evening to celebrate the end of yet another peaceful season but the supply of ambrosia had been sparse. This was only the second harvest of the spring months and the Rains had come early.

Cara cursed again and picked the fruits with greater energy. At least she could work her hardest; the gods could not deny her that. The sounds of rolling thunder galloped across the vast meadows like a band of horses, herlading the oncoming storm. Once th Rains reached the ambrosia fields the crop would be lost, and they must wait another two months before they could harvest again.

“Why must they come so soon this year?” Cara asked herself.

A voice from behind her responded, “Because the world is changing. Didn’t anyone tell you that?”

A pair of hands wrapped themsleves around Cara’s slender waist and hoisted her off the ground in one great motion. Cara let out a yelp and began beating her fists against the hands that held her. “Let me down, Farian. I don’t have time for this!”

“Oh, you never have time for a little jest! Maybe some play would do you some good!” Farian said as he whirled her around in fast circles. He set her back down, and Cara dizzily took a swing at Farian’s face. Surprisingly to both, it connected but not hard.

“Oof, ha ha. Even when addled the lovely Cara still has some fight in her!” He laughed as he dodged the second swing.

“Stop it this instant!” Cara yelled, “The Rains will be here soon and we still have picking to do.”

“To hells with the picking. I think the gods will survive if they miss one feast.”
“The gods will but I may not. You know how they can be when their hungry.”

Cara resumed her picking, mindful of how quickly the storm was approaching. Farian was watching her.

“Either leave or help me. You know I don’t like it when you stare at me.”

“You say that as if I could help it.” Farian smiled, “Anyone who wouldn’t stare at such a beauty must be missing a pair of eyes.”

Cara blushed, but she would be damned if she let Farian see, “Does every woman fall for that tongue of yours?”

“Some,” he said.

Cara kept picking the red fruit and Farian kept watching. From a distance over the sound of thunder came the low bellow of a horn; a great, yawning sound. “I suppose that’s all we can do for this harvest,” Cara said. She cupped her hands and yelled to the other fieldhands, “That’s enough, get back to shelter! We’ve done all we could.” The hands that had remained gathered their baskets and began to walk back. Cara stooped to pick two last ambrosia and place them in her basket.

“You’ve never stayed out in the Rains, have you?” Farian asked suddenly.

“Of course I haven’t. Everyone knows how dangerous that is,” Cara answered without even looking at him.

“What if I told you it wasn’t dangerous?”

“I suppose you want me to believe YOU have braved the Rains?”

“And what if I did? Would you think me brave?”

“I’d think you stupid. More stupid than I first thought.”

“I’m glad to hear you think of me.” He grabbed her again, only this time he hoisted her into his arms and began running. Running towards the bellowing clouds that were now almost overhead.

“What are you doing, Farian?” Cara asked, beating his chest, “You’ll get us both killed!”

“We won’t die, love. I promise you.”

“Alright, believe you,” Cara said hastily, “I believe you’ve been in the Rains, just put me down!”

“Not until you see it. Not until you’ve seen what I’ve seen.”

The clouds were above them now. The bright blue sky was cut by a great cloud of black before them, with lightining forking and spraying overhead. Great claps of light and booming sound filled Cara’s senses and she felt liek screaming. She could do nothing in Farian’s grasp but hide her face in his tunic. That’s when she felt it. The water burst from the sky in great sheets and burned her skin as it came into contact. Farian was running faster as he heard her cries. Suddenly, he slid and came to a stop and Cara no longer felt the sting of the burning Rain but she could hear its sound clearly. She lifted her face from Farian’s chest to see that they were under a small cloak stretched out from a stone that was hidden in the field. There was just enough room for them both huddled close beneath its protection.

“Are you alright?” Farian asked, “I thought I could make it before the Rains began.”

“I hurt a little, but unharmed,” she said, pulling small patches of hair that burned from her head. “What is wrong with you? How will we survive the Rains here? If the fields flood there will be nothing left of us but bones and ash.”

“The fields will not flood,” Farian answered with an alarming conviction, “I wanted you to see the reason of the Rains.”

Cara looked at him with questioning eyes, but he said no more. They both stared out into the mist of red water that poured from the sky, burning the meadows of ambrosia as white steam and smoke rose into the blackened sky. Back at the shelters, Cara knew that the hands were now preapring the evening feast, boiling the ambrosia down to a syrup and basting all food with its divine taste. Meats would be more flavorful, fruits would burst with succulent juices, vegetables would lose all staleness and perfectly compliment each dish. Ambrosia had no taste of its own, but only perfected the taste of every dish it was prepared with. Cara’s mouth began to water and in that instant she hated Farian for stealing her away from the season’s feast.

“There’s nothing to see here, Farian,” Cara said with a note of anger, “We get to eat with the gods once a season, and you took me from it.”

“And did you ever wonder why they gods only eat with us once a season; only when the Rains come?” Farian asked, “Its because they want no one to see this.”

As if beckoned by the sound of his voice, the Rains stopped and the thundering ceased. The dark clouds moved on past their small canvas, but the blue sky did not follow them. Instead, it was as if the fields were lost in a great expanse of glittering diamonds, millions upon millions or shining lights glittered and black expanse above. Cara stared up in wonder. The suns were no where to be found only the magnificent shine of the million lights.

“What… what is this?” Cara asked

“I believe its called ‘Night.’ I’ve read stories of a time when the suns do not shine and the world is cloaked in darkness with the watchful eyes of something called ‘stars.’ I believe those lights are what they are.”

“They’re beautiful.” Cara could not keep from staring. Her eyes were taking it all in, the brilliant lights in the sky. Sometimes it would look like one fell leaving a bright trail stretching from one end of the world to the other. The falling lights would cross and form patterns, like some unseen hand were writing on the heavens. Cara gasped and sat.

“It reminds me of you,” Farian spoke softly, “I said so when I first found this place. I could do nothing but stare at the sky, marveling at how beautiful it was.”

Cara turned to him and saw that he was looking at her. Gently he took her face in his hands and kissed her. Warmth flooded Cara’s face and lips but she stayed. If she did not love Farian she loved this moment, and she was grateful to him for showing it. She kissed him back.

They embraced and looked at the sky together. Cara’s mind was crowded with questions and she could not ask them fast enough, “How long does this ‘Night’ last? Does it come after every Rain? Why does it only come once a season? And why would the gods not want us to see this?”

Farian sighed at the last question, “I’m not sure, but I believe its because the Night is more beautiful than they are.”

Cara became silent at this thought. The gods beauty was all she knew until this moment. It felt as those this Night made life different, like it somehow changed her just because it existed. When the suns came back, she would be the same Cara but a different one too. She knew that there was a whole other world that the gods prevented her from seeing. Was there something even beyond the fields, in the lands where the Rains came from?

Cara yawned. She didn’t know how tired she became from a day of picking and she lay her head on Farian’s shoulder. In her last few moments awake Care stared at the night sky and wondered.

Wednesday, May 18, 2011

Ancestors, Pt. 2

Over the course of the following month I had all but forgotten about the beautiful woman in red. I was convinced the encounter was due to some early onset of the flu or another mental malady. Perhaps my lunch had been disagreeable with my stomach, and my mind had decided to take part in the argument. In any case, I had returned to the cafe several times since the ghostly encounter had had not seen her again. Either she was simply a mad woman running loose, or my imagination had gotten the better of my faculties which was prone to happen from time to time, as my mother had always suspected.

The month of June presented itself with its own mind-jarring troubles, I’m afraid, specters notwithstanding. I had lost yet another job with the paper and I was immanently in danger of losing my present living arrangement with a rather young and seedy theater entrepreneur, especially since it was now both residents who failed to “bring home the bacon” as it were.

“You should move back in with your mother,” he said in passing one day, “That’s what I plan on doing.”

“Don’t be absurd, man!” I said, “I would never become such a burden. You may get away with such a scheme, but I am almost twice your age! Such a thing would never float well with my ego, and my mother would never let me live it down.”

“Your brother, then.”

“He’s a sorrier lout than you!”

“But he has got a job, hasn’t he?”

I paused, “Well, yes, he’s becoming quite the businessman dealing in soaps, but to room with a sibling at my years is almost as terrible as rooming with one’s mother.”

“Pity,” he said, “Dear ol’ mum must be proud to have such a dignified and respectable son.” He laughed and lit a thin cigarette, nestled beside our fourth story window. I could not abide the smell of smoke, he knew well, and so I took that as my cue to exit. I had been meaning to pay mother a visit, in any case.

The walk across town to her flat was a long and dreary one. It had been raining for several days and I had failed to remember to grab my umbrella in my haste to avoid suffocation. It was not a downpour on the streets of Chicago, but it was heavy enough to seep through the seams of my overcoat and make my suit thoroughly damp. By the hour I reached her doorstep, the only dry part of my person was the thinning hair beneath my hat.

“Get in, you fool!” she said upon seeing my misery, “Who leaves their home in this weather without an umbrella! I raised you better than this. You’ll catch cold and give it to your frail, old mother!”

“I certainly apologize should it ever come to that, mother,” I said.

“I suppose I should worry,” she said, “You haven’t given me anything in years! Why should I be concerned that you would start now?”

“That isn’t fair, mother,” I responded, “You know money has been a hard to come by these last few years. Besides, I gave you that book last year on your birthday, remember?”

She prepared two saucers of tea as I sat at the modest kitchen table, “Oh, what woman my age wants to read these days,” she exclaimed, “I’ve got to keep up appearances to the other widows at the Society! Your dear brother got me these.” She tilted her head to show a pair of pearl earring dangling from her ancient earlobe.

“You’d best be careful, mother,” I said, “With pearls such as those it may be difficult to hold your head so high. Why, they might prevent you from looking down your crooked nose to anyone else!”

She gave a cackle that sounded more like a cough, “Say, what you will about me, but the Society maintains certain standards. It take more than just losing a husband to hob-knob with those kind these days. And without them, your dear old mother wouldn’t have a thing to do but spend more time with her dear, loving children.” She pinched my cheek and gave it a little slap at the end.

“By God, I shall seek a bank loan immediately! Fine furs! New slippers! The greatest necklace money can buy! Anything to keep mum happy and away!”

We laughed so hard that the tea waved and spilt onto the table. Mother wiped away a joyous tear, then said, “Oh, it would be a joke like that that would have kept your father roaring for days, God bless his soul,” she patted my hand, “It was sweet of you to visit on the anniversary, dear.”

“Has Terry been by?” I asked.

“Not yet, but he’s been busy with soap these days,” she said, “At least one person in this family can still hold a vocation.”

“Mother, don’t be cruel,” I said, “You know that I’m trying.”

“I know that, dear, but I’m worried is all,” she said, “you got to learn to stop chasing these dreams of yours and settle down. Find a nice wife to take care of you. Have children. Get a proper job and stop with this writing nonsense. Its what yoiur father wanted, and God knows I would feel so much better.”

“Please, mother, not this conversation again,” I breathed in deep and prepared myself, “I cannot be something I am not, and I cannot be Terry?”

“But Emith, dear, Terry is your younger and he already has two lovely children! You’re slowly reaching middle age and have so little to show for your life. One book is all, and it s a wonderful book, Emith,” she said quickly seeing the hurt in my eyes, “But it cannot feed you, or keep you warm, or love you like a family can.”

“I’m beginning to see that clearly,” I said

“Oh, come now, don’t be sore. I only want what’s best for you.”

“You only want more grandchildren and pearls!” I said playfully.

“There are few people in the world who can appreciate the value of such things,” mother said, putting her hand to her ear, “But enough of such talk. How would you like to play a game of chess? I tried to teach the women of the society but they showed absolutely know interest.”

We had played several games that consisted of forks, blocks, and draws. We had always taken each loss against one another deeply personal, so most games were taken to our wit’s end and finalized with nothing but a pair of kings and pawns. Always anti-climactic.

Upon leaving mother’s flat, she gave a final word of judgmental advice (she simply couldn’t help herself) and sent me home. The dampness had cooled in the setting sun, making the air heavy with an evening fog. As I walked, I encounter a most curious sight. On the side of the road, underneath the orange glow of a streetlamp, stood the contradictory figure of an Indian man, red-skinned with braided hair, and wearing naught but a pair of animal skin pants and long feathers beside his face.

When I saw him I stopped. My eyes took him in for a few moments, and decided that the appropriate course was action to take was to blink. I did, several times, but there the image remained. In the bloody middle of the Chicago city was an Indian savage, far from any tribe, plains, or hunted animal. He stood squarely between me and the entrance to my recently unaffordable home and so I had little choice but to pass his figure. I chose to walk quickly past and avoid any sort of contact; eye, courteous, or otherwise with the hopes of being pleasantly ignored.

Perhaps I moved too briskly. Mayhaps I expelled a cough that brought attention to myself. It could be the case that I stared at him a little too long. Whatever my mistake, he turned to me as I walk towards him, and he stared at me with the deepest and most lively eyes I had ever seen. I could not help myself but stop my brisk beeline to my apartment door. We gazed at each other, and neither of us said a word.

After a brief moment (it could have been a second, it could have been a year) I started to slowly pass him. Still silent, his hard, stone-like face followed me as I went. I dared not match that sort of visage, and so I glided past without another look. Coming to the door to my apartment my keys jingled as I removed them from my damp pockets. I dropped them as I tried to open the door and used the opportunity to take one last look back. He was gone. Only a single lamppost met my eyes. Again, my eyes determined the appropriate response would be to blink, and so I did, looking both left and right for the mysterious Indian, but he was no where to be seen.

That night I slept soundly, better sleep than I had received in weeks. I awoke with the rare existential sense that all was right with the world, and that today was a day of destiny. I lept from bed, arranged my clothes for the day, and decided to find a new outlet for my writing. I would use my recent misfortune in unemployment to begin a new book, one that would sell, and one that would love me as a family would, despite my mother’s beliefs to the contrary. It wasn’t until it was noon time and I was a quarter of the way through the twelfth page that I realized I was writing about the woman in red.